Description :
From Genome Similarity Track
Location :
Scaffold_1012:5599- 7296
Sequence
1697 bases(100 bases per row)
TCTCGGCGTCCGAGACAATGCATATTTGCTCGATGCGTCCATCGTGCAAGTCACGCGCGAAGCGCTTCCAGCTCATGACTGGAAGCGAAGTCAACTCCGA
CGCTTGCGTCGGAGGGTTAGCGAGAGTCATCTCCCTGTACCGGGACCCGGCGCAGGTACGCGTCAAGACGTTCAACGTCTCGACGTCCGGCTTCTCAGCC
CCCGTCTGCCCGGCAGACATTTCTTGTAGCGTCTCGGCTCCAGTCCGAGACTTGCGCAGCGACCTTCGCATGCGCTGTCTTCTTGTTTTGCGGAGCCCGG
CTCCGCTTGGTTCTTGACCTCGTCCAGGCCCAGCCGTGGACGGGTGTTCTTCTTGTATTCCGCCGGCGGGTTCATCACGCGGGCGAGCGACTTCAAGCCC
GGCTTGGTCGCCCGGCGCTTCGTCGTGCAGCCCGGCTGCACAACACCATGCAAGTTTTTCCGGTGCGGGACGTTTGCAACCGTCCGCACCTCCTGCAGCG
TCGGCTCCCGGAGCCGACACGCCATCTTCACCTCGACGCCTGTTATTGGTGGAGCCCTCCATTACGGAGGGTGCGTCGGCTCCCCGAGCCGACGAATCAA
GTTCACCCAATCCATCGACTCCCGGAGTCGACGGCGTTTCGTCACTTTAGCTCTTATTATTGGTAAAAATCGATCCAATCAGATTCGCGTCAGCCTCCAC
GGCTGAGGCGTGTGACTCGCCTGCGTCATCCGTGCCCCTAGAGGCCGGAGACTCTTCCTTATTCGCTGTAAAGCGGGTGTCGACCTCCGAGGTCAACACA
TTTCCTTCATTAGCTGTCGGCGGCAACGCCGACGCCAGCTGCTCTTGCGCGTGTGCTCGCGCGCGCCCAGGGCGCTCCGGGACAGCGGCGTTAGGCGCTG
GCTCGAGTGGGAAGTCGCGCGCACCTGTCGGTGCGTGCGTAGCGGCAACAGGGCCATCGCTCACTGTTCAGCTGTCGCGACCGAAGCGCACGAGAGTGTG
CTTCTCCCAATCGATGACCGGATCATGTCGTGCAAGCCACGGCATGCCCAATACAATGTCAAACTTATCGTCCAGATCCAGGACGATAAAGGTCTCGATA
AACTCTTGATCTTCATACGTGAAGCGCACGCGTACCATGCGCTTCTCGGTCTTCACGACGGCACCCGTTGCCAGTCGTACTTCCAACATACTTCGAGGTA
TCTTTAAATCCTCGAAGTCAAGCCTTGATAGACTTCGCAGTCGAACAAAGTTCTTCGACGCGCCAGAATCTACCAAAGCACGGAGAGAGCTGCTTGCTCT
CATCGAGTTCACATTCAGGATGACAAGGTCAGGCTTGTCATCTTGGTTCTTGCAGTGAGAATGAACCTCACTGGTGGCTGCAGTCCTCAGTGTCGCGTGT
CCAAGGTCGACACGCGGAACTGCATTACCAGTAGGGCGCCCCGCGCCTACTGGATTCCAGCATTTTTTTTGTTTGTCCGCGACGATGTCCGGCATCGCCG
CGTCGACCACCATCTCGGTGCACGGGTGCCGTGCACTCTCGGGCATAGTGACCGATCCTTCCGCAACGGAAGCATCGTACATTACTTCCTTGTTGCTGTT
GATAACCAACAGCCGTTGCATTCGAGAGGTCCATTGGTTCCGGACCTCCCGCTATCGCGACCGGAGGCGGTTGGAGCCTCGGCGCATTCGCTTGCAG