Description :
From Genome Similarity Track
Location :
Scaffold_1156:5598- 6933
Transcript NameFunction/comments
Phypl_g12588endo-1,3(4)-beta-glucanase, putative

Sequence
1335 bases(100 bases per row)
cgccggcgccggcgagGTCACGCTCAGCCCCTACAGCGTGCGCAGCCTGCCCAAGAGACTCGAGGTCTCGTACGGAGACTCCCGCCGCGTGGCCACCAAG
GACGCCGTCACCGAGTacttcaacgtggacgcCAGCTTCACGGCCTACAGccgcaaggcgctggccggcaacgagacgcccagcgccttgctgGGGGACG
GCAACAGCACGTCCAGGAACGTCGCGGCcttcgacgtgctgtccgtgctgctgcagtaccaCTACGAGGAGGACAGCAAGTGGATGAAGGCGCCCCTGGC
GCGCGGCTCGCCCTACGTCACGGTGGAGTACCAGGACGTGCTCCCCGTGCTGGAGTTCAACGCCACCGTGTCGGCCATCAACGaccagcaggtcgagcaG
AAGGACCCGTTGGCCCCGTgggacgagctgcagacgtgGACCAGCGACAGATTCGAGCTCGACATGGAGGTCTACGGCACCGGCGAGAGCGCGCACGGCA
CGGGCAAGGCCCAGCAGAAGTGGATCCTGTACTTCGACAAggtgcgcacgctgcagctgcagttcgccgacgagaaggactATCGGCCGTATAACTGGAG
AGGCGAGCTGACCACGCCCACCAACATTCGCCTCGTGGACACGGACTTCTACACGGGAGCAGCTCGTTTGGCGATTGTGCCGCAGGGAGCGTCGCCCGCT
GCGGTGGACGCACTCGACAAGGCCGCAGCCATTTACCCCGTGGGCTCCTCGATCACGACGGATGTCGACAACGTGAacgcctcgttctccttctgctgga
agacgaAGCGGTTCCCCGACCTTGGCGAGCCGAACTTgaactcgacgtcgactgCTGAACTTCTCATGCTGGCGAACCCGCACCATGCCGCGACGTTCAA
GCCTGACAGCGATGTCTTCCAGGTGCTCGGACAGTTTGGGCACCGCACATTGAAGTCGAACATGACGGCGGTACTCGGCAGCTGCTGGGAAATGCAGGAG
ACGCTGCCGGCGGCCTCtttccaagaagaaagcgtGCAGATCCAGCCGCAATACCTGGAGGCGATCAAGGTTGCTCTGGCCAACGACTCCAACTACACGC
CCGAGGCTGACGACCCGTACTACTTCGGCAAGGAGATCGGCCGTCAAGCGCGTTTGGTTCTCATTGCTGATaagctcgacgagaaggagctccGCGACGA
TATGCTtgacaagctggaggagtgGTTGACCCCGTGGATGCTTGGCCAGAACAGTGACCACTTCGTGTACGACCGCAGCTGGGGAGGTCTATGCTCACTC
AACGGACTGAAGGGCGTGTTCTGGATGACGGACTT