Description :
From Genome Similarity Track
Location :
Scaffold_331:5597- 7266
Sequence
1669 bases(100 bases per row)
ACATAGGTGTTGTTATCCTATCATCGTTATTTTAATTACGTGAAGCAAGCTTGGAATTTGTATGCAGCAATTGTATTAACCCGCTTAGGACGGGGCCAAC
AGCTTAGGTCAAGTACTGTATCAATACTTACGAATAATCTTGCTTGAAGTACTTTCAATTCTTCAAATGAGAGATTTTCTCATCCCTAGCTTCAAGTTAG
GCCAAATAAGATACTACTCAGAATCACTAGCTTCAAGTTAGGCCAAATAAAACACTCACTGTCAGAACCCCCGATTTTTGCAACAGTGGTACTTTATCAT
TTGATAGAGGAGTGCTCGATGAAAGGTTATACAAAATCAAAGGTTTGACGTGTCCGAAAATACCCGACATCAGACACTAAATACCCGATATTTATGACTA
AACAAGGTAATTCTGCCACTAATTTAACGTTTTTACCCGACACGTTTTGATAATTGCAGTCAAATATCGGACATCAATTACTCTAACAAGTTACGGCTTG
GGAATGGAGATAATAGGGAGATTTCGGAGATGACTTCTCTTTTTCTTTTACCGTAAAAATTGAAAGCAAAGTAAAAGCAAGGGATTTTGTATCGACGATT
TCGGTGATAACAATTTTTCCCTAACGTGACGGATCTGTAATTTGCCGATTTTGAGCTACATTCAATCGACCATATCTGGCGAAGTTCAAATTATCTCGAC
GTGAAAGTTGCAGTGTCGAACTCTTCTTTATGAGCTTTATCTCATCGTCCGAATACAAATCAAGTGTAAGAGTTTGAATCAGGGCAAATAAAATGTCAAA
GTTTGGCGCTCAAACAGGCTATCGGTGATTTGCCGAAATTTAACCTTGAATTCAGTAAGGGAGTTTTACGGCTTTGATGAAACATAATTATTAATTTATA
GAGCAATATCATATGTACGCAGTAAAAATATTTTACAGGTCATACTTGGTATGAAAACAGGCGAGCACCCTCTTCAAGTTTGTACTATTCCAACCATAAC
GTTTTGAAGGTGCCAGTTGTTGCGGGCTTTTATTTTATCCAATCATATCAATTCTTGAATTCTATTGGGTAGTGCAGCTCGGCAAATCACCGATCTTTCG
GCAAATCACAGATCCGTCACGTTGCCGTATGTTTGGGCGAAATGGCTTCCGGGTGATCGGGGAGCCTACTCCTCAGCCAATTTTAAACATTATTAACAAC
GGATTAGCCCACGCCATCCGCAATAATGTCATACGTGGTGTGGGCTAGTCAGCATGTCATGAATCGAAATATTGGCAGAGGAGTAGGGTGCCCACTTTTG
AAAATTGGCATGACGATCGACTTTTCTGAAACATTCGAAAACACACGACTTCCAAGCGAATTTAAATAAACTTCATAATAATAATTCCATCTGTTAATAT
GGGCAGGAATTTGCAGTCAAGTTCAAATGCCACGAAAAGCACGTTCACGAACACTGGGACGCCGACGAAAAGGTGTCCATAAGTGCGCCAATATGCCCAT
CTTAGAACAGCGACTACGACGAGTCACCAGAACTATCGACACCGTGATCAAAGCAGCAACAACAAACGTGCGCAGCACTCCTACGTCGTCCGTCGGTCAA
CGCCGTGTGGCTTGGGCAGTCTACTTTTTGGACAACTTGGGTGTTCCACCAAGCAGTGCATGGCACGGC