Description :
From Genome Similarity Track
Location :
Scaffold_167:55967- 57111
Transcript NameFunction/comments
Phyci_246623Hypothetical protein

Sequence
1144 bases(100 bases per row)
TACACCATTTCCCAAGCAACTTGCAAAGTTTGCCAACAAAAGTGAAATCGAGGTTTTTCTAAAAACCTAAAACAATGTATACGTAACAAAACATTAGCAG
CTGGACATTTGCCCATCACGCGTTCCAACCAAACTGAAATCTAAACTTAAGTGCCCAATTTCGTGTCCTCACAACGCTCCGCCTAGGTGCACGCCTTTAC
CgcttggcgctcgatccaccaaacgaggcgccgcgtgattgctgccactgcctgcgccactgtctccttaattatagccagccggcgcgCTGTGTATGTG
TCATACTCACCCCGAACAAGTAGCTCTTGTTCCTTCGTAGCCATGAAGCGCCGCATCTTCGACTTGAGCACATTCCAACACCCCTCGATGGGGTTCAGCA
TGGGGCTATACACGCCCAGCCTTAGCAGTACCAGCCTGTCCCCGTTCATGACGCCGTCCTCCGCCAGAAATTGGCGAACCAGATCTTCAACCTGACTATG
TGTTGTTGCTCGGGGCCAGCTCCTGATACTCCAACGTTCGCTGAGCCGCGACGAACAAGTTCGCGATGAACCGCGCGGTTTTCGTCTTCGTGAGAGCGTC
CTGAGCAGCACAAGCCCAGTAAAGGCTGAGACGCCACCTTGAACGCACAAGTTCTCACCTTACGTTGGGGGCAACTGCACGACGGCACGCTTGCCTACGC
GAGATCGCCCCTCCGAACGGGACAAGTACAGATTGAAGTTGGTATCGTCTTGGTAGACGATCATGTCCTCGCGGGAGACATGACCGTCCACCTTTTCCAC
GAACTCCTTCCGCTTCTGCTTGTTCAGTGTATTGTTCATTGTAGCCTTCTCGATGCGTAGCTTCTTCGTTGTGTACGGCTTGCCTTGCTCACAGAAACCC
CTGTGTCGCTCAGCAGCCTGTAGCACATGTCAGTTAACGTAACGCGGTAATCCTCATCTAAATACTCTTCCAGCTTAGCAATGAGCTCAACGATCATTTT
AACGCACGACGAGCCCTCACCCTCTCTTTGCTTTGGATCCGTGCCGCTGTCAACCACGTCGCGGCGAGCAGTAGCATCGGGTAGGGCGTTTTGGATAGCA
GCGAGTTTCCAGTCTCCCCCTCCGCGAAAACCTCGGAGAACTCG