Description :
From Genome Similarity Track
Location :
Scaffold_152:55959- 57348
Transcript NameFunction/comments
Phypl_g4293hypothetical protein PHYSODRAFT_495899

Sequence
1389 bases(100 bases per row)
atgaGCTACAACAACcggcgcggcggcttcggcgggCGCAGTCGCGGGCGCGGCAACcgcggcggacgcggcggctACGGTGGCGGGCGCGGGGGTTacg
gcagcggctccactGTGGGCAACGAGGTCTGCCGGCGCTTCATGGACGGCGGCAAGTGCGAGTTCGAGCAGACGTCGGGCGGGCGGCCGTGCCGCTACCC
GCACTTTGTGAAGACCATCGGCGAGACGCGCGGCCACAGCGGGTCCATcaaggacgtggccatgtgggccgagcgccagcagctcttcacGTGCGCGGCG
GACGCCAGCATCAAGCTCTGGGACTGCGCCACCTGGCAGGAGATCACCACCATCAGCGTGCAGGACGCGTTGCCGCCCGCCGCGGCCAatggcggcagcg
gcggcggaggcagAGGAGGCAACCGGGACAAGACGCCGCACACCgagggcgtcgtggcgctcgtgctgtgcGGGCCTTTCCTGTTCGCGGGCTTCGAAGG
CCGCTTCCCGCCCAACCCCAAGGTGTCGGTGGGCATGGTACGAGGGTGGAACCTCGAGAACGCACAGGCCCCGCCCTTCGAGTTCCTAGCGTCCGAGATG
ATGCCTTTTGCGCACACGATGAacgtgcaggcgctgacggtggcgacggacCCGACGGGCAACACCACGCTCttcagcggcagcgccgacggaTCCATCC
GGTACTGGCAGATGGACACGGCCACCAACCAGTTCAAGTGCCGCGGCGTGATGGAGGGACACGTGCGCGGCGTGACGCGACTCAAGACGTTTGCGGTCGG
CGGCGCACCCATCTTGGCCTCGGCCAGTGTGGACTCGACGATTCGGCTCTGGGACCTGGCCACGTATCAGTGCGTCAAGGTGCTCTCGGCCGAGGAAAAT
GGCCACACCGACGCCGTCATGGACCTGGAGTTCTGGGTGAACGGCAACGAGACGTTCCTCATCAGTGGCGGCTTGGACTGCGAGATTATCGTGTGGGGTC
TCACGCCGcccttccagcagcttttCAAGGAGACGCAGGACTCGCAGGTTACCGCGCTTTGCGGCACACAGGATGCCGCTCAAGCTCCGATTCTTCTCAT
TGGCATGGCGGTAAGTTACTCTGTGGGTTTTGGCGTTTGACTTTGTTGAAAAGAACTAATGGTGTATCGTTATATATTGCTGTTTGCAGGATGGCACGAT
CTcagtgaaggagctgccgTCGTTCGCGTATAAGACGACACTAGGCGCCAATCTCAATCATGGCCACCAGGATGCTGTGCGACGCATCACCACTGGCCCG
AGCAATACGTTCTTCTCCACTGGCAATGACCGGAAGATGATTGCCTGGCAGATCACAGGCGATGCTGCCTCTATCCAGTCCAAGTAAAC