Description :
From Genome Similarity Track
Location :
Scaffold_319:5595- 9421
Transcript NameFunction/comments
Pytul_var.sporangiiferummaker-pug3_contig_319-fgenesh-gene-0.6ATP-binding Cassette (ABC) Superfamily

Sequence
3826 bases(100 bases per row)
ACTTGGTGAACCCACCAGCAAAAGACCATCACTCTCGCACGCTCTCATCTCCGTTGTCATTGGCTTTCATGCTACAGTGTGTACTGTATTGGCCGATAAG
CACCACCGCGACCAAGCACGCTTCTAGCAAGATTCGATTCCAGCATTACCACCTCAGTTGAGGCACTCTCCTTTTTAGTCATAAAGGAAGAATGATACGG
AAAAGCAAGCGCATCAATGCAAAATGTCAGCTTCACTTGCTCGCCCATAGGTGGCCGGAAGCACGCGCTTTCGCCGTTTGTACACGTTCTCGTTTCAGCA
AGTTACGTTGTTAGCTCTGGCAGCAAAGCGCCATTCATCCGTCCAATCCGATTTGTATCGCGGATACTCACGTACTCACAGGAAAATCGAGACGACTGGC
GGACTGAATCTTGGGTTGGCGCCCCAAATCAGAATTTCGGTATTTTGGGCGGACCGATGTCCGCGCGACAGTCATCAAAGTCGACGTTACNNNNNNNNNN
NNNNNNNNNNNNNTCGCCGGGCGGGCGGTCTCGAAACGCAAACTTTCGCGGCGGCGTCATCGGTTCACGGCAGAGACCGTCCGGCCGTCCATCGGTCTCC
TTGCTCATCCAAACAGCGCAAATGAGCCATGAACCACACCTCCCCCCATACTCGCAACCACCTTATTGTACAGTACCGTAGACGCACACCGTATGAGCTC
TGCATGGAGAAAAACATATTGAAGGCGCTGCGGGTCGGGGTGAGTCGTCAAAAGTCAACAGCAAATTGAGACAGTAGTGGTGCTTGTTGTGCAAACAACG
ACCAAGTAACGGGGGTCCTGCCAAAAGTACGAAAGTACCATCACTCCGACGCATTGGCAGCATGTTGACGCCAGGTTTTCCGACGCTCAAAAGTTCACTT
TCCAGACGAGTGGGGACCCCGCTGTTTGGACTCGATCCAAAGGTCATCACATCCAGAGTGCTGTTGCGTGGCGAAATGGTGGCAATGGTGCAAGGTGTTG
ACATGGCGGTGCGCTTTTATGAGGTCTCATTGAAAAGCGCGCGCCAACATTCCGACATTGGGATAGCGCCGTTGTTATTTCAGCATTTGCGTCTCATTGG
GAAACCGACTTGTCTCATATACTTTTGGACGGACGGGCGAGGGAAGGAACCAGCAGGAAAAAAGTCAATCCCACCTGCTGCTCGTGCTGCTGCTGGAAAC
CTAACAGGGAGATGGACCCTCCAGAGGCAACACACACACTGTTGCCAAGCCGTGTTGCGTTGTTTTTTTTTTCTTGTGGTGACTCTTTTGCGAACAAATC
GAAGGGAAAGTATCAGCACTTGATCCAAATTGCCTTTGCATTCCAGTCACGAATCAAGCAGTGGCATGAGGTGTAGCGCTCTGATTCGTCCGTTTTTCTG
CTTGCACATAGCGTTGTTTGGAGTATACTAACTGCCAGATATGTGTTGAAGTCGACAGTTTCGGTGGCAACAAGGACGCATGGACATGAAACGGATGTCG
GCCGCCTGTGAGAGACACAGACTCGATTGATCCTGCGGACGTGTTTGTCAGGTGATGATTGCTCTCGGCAAACAGTTTGGATGATTGGGAGGGATGGGGT
AAGTGTTTTACACGGCGGAGGGACGGACAGGGGAGCGCTCGCTCAAAAGGAATGGAATGGCTTCACTTCGGTTTCGCTCACGTCCTTCAAGTGCAAAGTC
CCGGTCGATTTGTCTAATTCAGTAGGGTCAATTGGTTCAGTTCAGACACATTCTGCACGACGTATTGGACTCAAGAAACCCCATGGCGACTGGCTTTCAC
TTTCTCCGTGTATTTCTCAGCATATTTCCTCTCTGCCAGCAGCAATGCTGCTGCACAAACTCAAGGTATTGTAGTTGTGTCATTAGAGAGCATGCAGGTG
CATGACCTCTCTCTCGCTCGCTCTCTCTGTGTTGTTCGTGGGTTTTGGCTTTTTTATACCCGCAAAGCCACAACACAATCCCTCCCGTCCCTGGTCGTGG
TCGTCCAGTGGAGATCGGCCCTCTGTATACGAACACTCATGTAAACCATGCAGTATTGTGAGCGAATATGCCTGATTGCACCGCGTCTCCATGGGAATCT
TGCAGTGCATGTATAACCAGACTGTCCATGTCGGTCCCTATGCAAACTGAACCAACGTCTTCTCTATATACGTCTCTCTCTCTACAGCGATGCGAATGCA
AACTCCCACATGCTTTGTTGCTTCTTCAAAGATCCGTTCGTTTCATTTCACGCTCGAAAAAAAATTCTTGTCACGAAGTGCGGGTGCGGTATGTAGGACA
GTTAATGCGACATGGCAAGTGGAGGTCGGTACATGTACTGACGGGCGGTCGGTAGGTAGGTACACTTCTGAGTGTACCGGCGGCCGACAAACGNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNGTCACCTTGCACTCTGGAATCCGGAGTGCAAGGTGATCCAGAGTCTGGATCTCTTGCCCTTCTGGTTTGACATTCTGA
GCAGCTGCTCGGTGTCACGATTAACCCGAAACTGGCATGGTGCAGCCTTGCGTGTACATGGGCTGGTTTGCTCCTCCGCATCCATGCGCACTCGAACAAC
ATGCGCATGTTGCATTCTCTCAGACGCCTAATGGGCGACTCTCGCTTTCGAATGTTATTATCGAGGGAAAAAACTCGACTTTTTCTCCATGCAACTGACG
TTTGTATATGTACGTTTTGAGTCAACTGGATCGCAAGCAAGACTGCGGCATAGCGCTCTCGTTTTCGACCATTCTTTGTCGAGCGCCGCCACACTCTAAC
TCGCAAGCCGACGGACAAAGACTTGGAAAAACAGAAACTACCGAGTCTCCAACCAGCAATAAGACCCACTGCTCGAATGCGACTCGAACTCACACAAGCA
TCGAGCTAAATGGGAATCGCGGAGGGTATTCATCTACACGCGTCCACACGGTATCAATAGTCCGTGCTTAGATCATGCTAGAGTTTAGCTTGGCCTATTC
CTAAAATGGGAGAAGCAACAAACACAGCCAGCTTTTTCTTTTTTTTCAGAACGTCCATACCGCAGCGTGCATCCCATGCGTGCTTGCAACGGGTTCGCTT
GCTTCTTCCTGTATGCATATCGCAAATATGTGTGTGTGCGCGCTTTCGACATGTCGTTCTCGTCACATGCAGGTGCTGGTTTATAGAATATGATACTCAA
TCTGCAAATACAAAACAGCACCCACCACATTGAAGCACAGCGGTCAGTTGCCCCATCCACTCACTCTACGTCTCATGCCAACAACATGCAGCACATCTCA
CCTCGTTCGATTCGCGCTGACTCACGATCTTGGGGTACTGAAACGTGCGCAGGAACCAGCGCTGGCCCACGGCGCTCATGCTCAGCTGCTTGTTCTTGAG
CACCGAGAGCTCGTAGTAGATCAGGTGCTGGCACGGCAGCTGGTAGAGCTGGTAGAACTCGCAGTCGCAGCCGCTGCAGTCGCGTTGCATCACGTGCTTC
TTCCGCGTCGCCTTGTCGGCCCACACGACCGTCTCGGGCTCGGCGCTCGTCTGCGGCGAAGGATTGGGTGTGCTGCCCGGCGGCAGAGTGGGACTTGAAG
ACACCGTTGCGCTTGCTGGCCGCGGGCCCCTCGTCACCGAGATCGTCGCGCTCGTCGTCGGGTTCCCCGTGTCCGCGTTCAGCGCCATGAGCTGCGAGCT
GATGAGGCTCACGGCGAAGCTGCTCAGGCAGTTGACCATGAAGTGCAGCAGCGGGTCCGAGCTGAACTCCGTCAGTGGCTTGGTCATCTCCAGGATCNNN
NNNNNNNNNNNNNNNNNNNNNNNNNN