Description :
From Genome Similarity Track
Location :
Scaffold_1168:5595- 7496
Transcript NameFunction/comments
Pytul_var.sporangiiferummaker-pug3_contig_1168-fgenesh-gene-0.1Heat shock protein 70kD

Sequence
1901 bases(100 bases per row)
CCGCGCTACATGGTCATCGTGCTCAAGCGCGTGTTGCTGCACATCAGTATCGCATTGATCTTCCGTATCTGCTCGTTCATGCTCACGACGCTGCCAGGCC
CAGCGCGTCAATGCCGGCTCGACTTTGACGAGACCTGTGTGGCGCGGACTCCGCGAGACGACATCCTCAAGTGTGTGATCCCAAACCCGGACTTCAAGCC
ACCCCACGGCCACGAGTTCTTTACCAATATGGACGCTCTGAACGGGTGCGGTGACCTCATGTTCAGCTCGCACACGATCTACACCATGTCGTTTATCTTG
ACGGCGATCAAGTACTGGCCAAACCGGTGGTTGCTGCTGTTCTTTGCGTGCGTGCAAATCGCGATCGCGTTCCTGATCGTCGCCTCGCGCAAGCACTACA
GTCTCGACGTGTTCTCGGCGCTCTACATTGTGCCACTGCTTTGGCTGACACACGATGCGTACTACAAGGACATCAACCACAAGGACGTCGGCGTCTCGGT
GAAGACGATCCACGAGTTCTACGGCATTGACGTGTCTGAAGAAGTCGGCGGCGAGTTCCACCACACGCAGCCATTGGACTCGGTCCAGGTCGCGACCGCG
GAGGAGGGCTTCTTGACGGAGAGCGAAGGTAATGCCCAAACCGAATTCCAGCGCAAAAATTCCATGTAACATGTGTAGATTTGAGGCCCGAAAGAAGGAC
AAAACAAAGGAACTGCAGCGGACGGATGGCTCTCTTGTCCTCGCAGGAAGAGAGTGCGTCGCCTGGTGTGACTGATTGATAGATGAAATTTTGTATTGGA
TTTCGGCGTGCTTGCGTTTTGCTTGTGATATTCCGTGCTGCTGGAGTGTCTTACTGGCTGGAGTACTCACGCTTGTGCTCGTTTACCTTATGCCGTACCA
TGCGCCAACCGTGTCGGCTGTGGTACTGGACGCGCATTTAGGTTCCAATGAGAATACTGGATTGCATATTATGGTGGAGCAGCAAGCCACCATCGGTTAT
CACAGCATTGATTAAGCGATGGCGCCATGGCCTTCTCTCCAATGGGGTTGGTAATGGCGATAGCGGATTGCACACCTCGTTGCAGCAGCCAGTGTCTACT
AGCTGTCACAGCACTGGTTAGTCGATGATGTTAAACGCATCCTTAGTTAATCTCCAATGCATATGCAAGCTTTACTATCCGTAATATGCACTGATCTGTG
AGAGAATGTCAATGTCTGTTAGGTCATCCAGACAGAGACTTGACGCATCGCTAGGACGGTTTATCCAGTTGTATGATTCTTGGTCTCTGTCATCGCATCC
CGATACAAAATACGGTGCCGCTGCCTGATCAAAGTGCGAATCGGTCCCAGATGACAGCTGGGTACTTTCAGCACCACAAGACTTTTGTTGGAAAAAACTT
TTGGAGGCTCTTTCCGTCGAAGGCACCTCGGGCTGAAGGCTTGACGCTATCACAACATGCCATGATTCACAGTGGGATGCACTCCCAGAGCACTTGACGC
GCACTTCCAACGGGTTCAAAGCGGGGTTGTAGGACACATCTGGCATGCGCACCGTCAAATCTTCACATAACTCGTCTTGGACGTTCGACTTCTTGTTTGA
AAAAAATTCTTCTGCTCTTGGGACGTCTTGCCTCGTAAACTTGCTATGCTTGAAGAACTGATCTCCAGAGTCATCTGCTTCTTCGTAGCACTGAAACTCC
AAGCTTTTGAGTATTTGTTCAAATGCTCGCTTTGATGTTCCAAAGCAAGTCCTCAAACACTCGTGGCTCCTAGGTCGAAGTTGAAAACGAGTGCCACCAT
CAATCCAGAAAATCTGGTCTTTTGACGAGTTGTTCGCAAGCTGTGAGTGAAGGCTCTTCAGGAAATTGTCGCCAACAATGTCTTCGCTTTCATTGGTACT
T