Description :
From Genome Similarity Track
Location :
scaffold_157:55944- 57067
Transcript NameFunction/comments
g4775.t1hypothetical protein

Sequence
1123 bases(100 bases per row)
ACAAAGAGTACAGTGGGATGTTGAGAAACAATATATGGGAGCTAGTGGAGAAACCGGAGGACGTCAAAGTGTTGACCAGCAGATGGGTGTATGTGCGCAA
GCGCAAAACAAGGTCAAGTCGAGCGACATCGAGCCCGTATTACTATTAAGGGCTGTCAGCAGAAGTACGGCTTGGACTTCTGGGAGACTTACGCCCCTGT
GGTGTGCATGGAAGCTGTAAGATTAATTCTTCTTCTGGCACTACACTACGGATTAGAGTGCCGTCACATCGACTTCGTGACAGTGTTTCTCAATAGCCCC
ATTAATGCAGAGATTTATATGAAGCAGCCGGAGTTCTTTGACGATGGAACCGGACGAGTGTGCAAACTGCTTCGGAGCCTGTATGGTTTGAAACAGGCCC
CTACGATGTGGTACCAGACACTTGACAAATACTTGAAGGAGTGTGGCTTTAAGAGATCAAAGATGGATGGAGGCATCTACTATCGCTGGGTGGACAGCAG
TCCAATTTTTTTTTACTCTCTACGTGGATGACATTGTAATTGCTGCATCTGCGGCAAACACCAAGCTGGTGCTGACAGAACTAGCAGATAAGTTTCAAGT
GAAGGACCTAGCCACTTTCTCTCGATAGAAATTAAGTACATCCCAGGTCAGTCGCTGACGATCTCGCAGCGAGGATACATTGGAAGAATTCTTGAGCGAC
TCGAGATGGACAAATGCAAGCCCATGCCGACACCACAGGCGAAGGGCAATCTTCCTCTTCCAGGTGACCCTGATAGAGAGGTGGTGTGCGTGAATAGCAA
TCCGGATATGGACGATCAGTGCATTGTTGGCTCTTTACAGTATCTGGTGAGTTGCTCTCGGCCAGATATCGCCAATGCAGTGCGAACTCTTGGGAAGTTC
CTTACCTGTTTCACGAAGGAGCATGAGGTGATGGCCAAGCGCGTGCTGCGGTACCTGCAAGGTACACGTGACTACGGTTTGGTGTGGTTAAAGCCTATAC
CGAGAGGATTATGGCTGATTGCCTATACGGGTGCCGACTTGGGAAATGAGAAGGATGATCGTCGGTCTATTACCGGTTATGTTCTACAGCTCAATGGCTG
CACGTTCGCTTACAAGAGCAAGA