Description :
From Genome Similarity Track
Location :
Scaffold_32:559436- 561725
Transcript NameFunction/comments
Physo_134583hypothetical protein

Sequence
2289 bases(100 bases per row)
CTTATATCCACTTAAGCGACTAGCGGGAAAGTCAAACGCTTCAGCAGGCTCCTTACTTGGTTGCTGGAGGTTGTTGAAGCACGTCTGATACATGACTTTC
TCAGAGAGACCAAGTAGCGACACACCATCAGTGAACATATCAAGTTCGAAACGTTTGAATAGTTCTCGCTGGGCTTTGATGGCCTTGATGAAGGGTACTA
CATCGAGGTTGTTGTACCAAATGAGTAGATCCTTGATTGACTTCATGTCATAGTGTTCCCAGACGAACTGTACCCGCACATAGTCCTCATCGCTGATGCT
AGTGCTACGAAGAGCACTGTCGAACGCCGACTTAGGAGGGACTTCCGGCTGACTGAGTACCTCAAATGAAGTAATGTACTCGTATGGGAAGATGCCTTTT
CCTAGGCCACAGACGCATCGAATCTTGTCATCACACTTGCACTCACCGAGATATGTCGACAAGTACTTTGCATAGCTGGTGCCTGCCGGAACATAGTTGC
TGATGTCAAGCATTTTCATGTCTGACGTGGCGATGCACATGTAGCTAGGGTTCTTGATGACTGATGTGATGTTGTCAGTACCGATGACTGCAAACAGGTC
CGCCTTGATAAGGTTGATGTCGTAGCGTCCAGAGTTGAATCCGAATACTGGTACCTGACCAATGCACTGCTTCAGCTTGCCATAATCCGAGCGCTTCTTA
CCGAATGTGAGCTTGCTGTGGAAATCGAAGAAACAAGCAAACTCCCCGTTCTGAATCCAAACATTGACATCATCCATCTTGTACGTCTAGAACAGGAACC
TCAGCGTCAGTCAAACCATGGACGTTGATGATTTTGCGGAGCAAAGACTCGTACTTCGAGACGTTGTACTGCTGAATCTTAGCGGCAACTTCCTTGATGT
ACTGGAACATATCCTTGAGCAACTCCTTCGGGTCATCGCTGACAAAGCATCGCACCTCCTCAGTCAAGCTGTCGGCCCAGGAATGTGTTCGTTTGTGAAG
ATAGTATTCTCTCCGTTTTTGACACCCGTAGGCTTGAGGATAGCCTCAAAATCATAGACAATGAAGTGATCGATGTAATGGTCAGCATCCTTGATGGAGT
ACTTAGTCAGCATGGAACGAATGCTGTTCGGAGCGGGTTGGTAGATGGTTGGCTGAGCTGGGAACGATTCGATGTTCACGCGTTCGCATTGGTTCTTAGT
GTGGTTGCGTAGCTTATCAGAGCTAACAAACACCATCTCACACGTAGAGCATTGGTACTTCTGCTGGAGCATATCAACGTTCGTGATGTAGAGAGCGTGA
TTCGTGCGACAGGATGTTGATCGAATCATAGTCCTTGTCCGAGCAGCGAATGCATTCAACCTTGTCCGACTCAACATCCATGTTGAAGACGTTGATGTTC
AGCTTGAAGCACTCCTCAAGCTCATCGAATTGGAGAATGTCGATAGGCTTGAAATTGCGGAACAGACCCAGAGTGTAGGTGATCTCCTTGTACGAACAGT
ACTGCTTGAAGGCTTGTTTGACCAGAGCCTGGATTCTGCGAGGATCCTTCTTGGCTCCCTCCTGCTTGTGATAAGCAATGCAGTGGAAGACACACTTGTT
GTTCGTCTTGGGGAAGTTGATGACGTGCTTGTTATCACGAATCACCTTAGGAATGACAGCCTCGCTATCACCCAGAGCATGGTCGCGTTGGTAGATATAG
ATATTGAAGCCAGTAATCCCCTTCACCATGTACCCGGAGCTGGGGTAGTTGAGCTTGTCAGCCAACTCCATGGAGCGAATCTCCGAGATCACCTTCTTAC
GAATATCATCCTTGCTGTTGATAGCTACAGGAGTGCTAAATACAGATGTGTTGCTAATATTCGGGTGGAAGTAGCGAGTCTCGCTGTCATCAGTTCTGCT
GACAAGCTTGTATCCAAGAGCGATGTTGACCTTGAAGGCAGACTTCTGGGTTGCAAGCACGTTCTCAAGCTTGTCGTAGAAGTCAGCAGGCTGGATTCCC
TCATATAGGTGCGACTCCATGTGTTTGCCTTGGTAGAAGCGGTACTTACTGTCTTCCTTGAAATCAGCAGCCAAATTCTTTTGGAGCTTGCCTAGACTGA
TCTTGTACTGCTTCGCTACCAATTTTTGGTTGATGGGGTGGGAAATGTTGCTAATGTATACCATGCGCCCCGTCTTGCCACGTACCTTAATACGGTAGCT
GCTACCCCATCGGATTGGGTTAATATTTAATCTCTTAAGACCTTCAAGCTCGTATGCGAACATTGCTATATATCGGTGGCTATATTATT