Description :
From Genome Similarity Track
Location :
contig_42:559326- 578787
Transcript NameFunction/comments
g9140.t1hypothetical protein
g9141.t1OWZ08073.1 hypothetical protein PHMEG_00019443 [Phytophthora megakarya

Sequence
19461 bases(100 bases per row)
AGTCTTCATTATCTTCGGCAGTGTCCACCTGTGTCATTTCGTGGTCCGCGTTTGCGTCACTCATCGACGCACTATCCATTGCTGCTTCCTTCTCCATAAT
GTTCCCCGATACGCCGTCGAGTTTGTCGCCACTTGGCGCTTTGTAGTAGTGATGCATGAACTGCTGCATAGCTCGGCGCCCCTCTTTACGCGACTGTCTT
GTGCTGGTGCGAGTCGGCGACCGTGATCTCGCCTTCTCTTCTGTTGTGCACGTCTTCATCAATTTCTGCATAGTTTGGATTTCCTCCGTCCCTGTTGCCA
ATTCCCATTCGGCTGGCGGGTGCCTCTTTGGTGAGGTGGATCGCAATTCACTGGTACATTGGCGGTCTTATTCTTTCCCCCGGTGAAGGCTCTGAAGAAT
TATCCCGCTCCTCGATGTTGTTTCCTTCCTCGCGAGGGGTTCATCTGATGTCCCAACTTTCTTTACGTTGGATCCCAACCTGTTGCTGTTAGAATCCTCC
TCTCTGTGGTCCTTCCCCGTGGCGATATACTCCTTGTCGAGACTGCGGTCCTGTTCTTAGTTGTTTCTTCGTAGGTTCCCCCGTCCGCTTCATGCACCTC
CTCCACCATCTCGATATCTCCAATATGTTGTTCGTCAGTTGATGGTGAGTCAGCTTCTGGGTCAACTTGCGCGTTTTTGTATTTTAAGTATTTGTTACCA
GTGTTGCCGTCATCCTCCTCCGCTATCTGTTTCGCATCACTGTGCACTTTGTTTTTGTTATCATTTTGCGTGTTGTGAGCTGCTGCTTCCTCATTCTTAA
TGCTGTGTAATTGTTCCCATTCCCGCGGTAGCGTTGGTCCCTCTGCTAGCACCGACGTAGGTTGGTGTTGGGCCTCCTTCCTTTGTCCCCGTGTGGGCAC
CTGCTGCTTCATATTCGTTAGATCTTGTTCCACTTTCCCGTCTAGTCCTTTAAGCATGCGCCTTAGCTGCTCCATCGTTGTCGGTAAAGCTCGTGGCTGG
TACGTTCTGGAACTCTTTCCAGTTTTGGACGGCTGCGCACCTATCACTCTGAATGTGTGTAGGCGAACGGTGTTCTCCATAGTTGCTTCCTCCACTTTGC
AATATTTGGTCGGATGCTCCGGTGATCTGCATGCTTTGCACGGCCAGTTTACATGAACGTCCTGATGATGCAACCATCTCTGCCTCTTCATGAATGATAT
AGCCCGTGTCTTTCAACTTCGGTGGGCACGCTTTCGCACGTATCTTCACAATCCACTGCTTGTCATTTATTCCTGTGTCTCCAATTTCCGTGTGAGCCAA
AGTTTGCACCTGCAAACCCATCTTTTTGCCTAACACCCATAACAGATCCTTGGATGTCATTGCCCCCTTCCTAAGCGAGACTGTGAAATTATAGTAGTCC
AATTTCACAAGTTCAAAAGTCGTCCTAGCCTCCACTCTTTGGCTTTCATAGTCAACTAGTTGCAGCAACCTCATTGCTAGTGGTAATCTCCACCCGATCC
ACCTTTTCGCAGCATTCTTGCCCTTGAAGGTGACTGTGATAACTCTTGTGTCACTGTCGAGCTCAATTCTGGATAGTGCTGCTTTGAATTCATCAATTTC
CTGTTGTTGCTTAGGCGGCGCCTCTGCTCCTACCGTGATCTGTGCTAACAGCGCTCCTCTTGATAAATTTCCCCCAAAACGCTGACCTGGCGCCAATTGC
GCATACAGCGGATATTCCAGAGCAATGAACATGTCCGTGAAAGTTGCTAGTTCCATTGGCGTCATAGACTGCACAAGAAAACGAGGTGGGAAAGGCACTT
CCAGTTCCTGATTGAGAATCATCAACAGCGCCCGATCTTCATCTTCTGTCCGTTCTCTGAGCTTCGTTATTTCTGCTACTGGTTTCATACACAATTTGAG
TAGGCGCTGTTGCTCCTCCGTGAGGTCCGCTTCTGTCGCCCTGCCTCCTTGTTGCGTTACTGCTCTTAGATAGTCCCCCGTCGATGGCGTTTGTTGTTGT
CTCTTTGCCTCGTGCTTGTTGCTCGTGAACGTGAAACAGTGGATGCGCTCCTCTATCTCCTCTTGGTCCAGCCCTTCCTTCACGACCCACTGCTTCAACA
GAAGTTGCATTCTTCCGGCGTGCTCCTCGTTCCCATTCTCCCAGAAGCTGATTATGCCCTTGTATTTAGCGCGCTGCTGCGACGTGATGTCATCCTGCCA
TTCTACTTCACTCTCCGCTGCTTGTCCTTGGCTCTTGGATGATACCGCTTTCTCGTCTTCGTACTTTTGAAATCTTCGCGTTCTGGCCAATTCATTGAGT
CGTTGCACCAGATGGAATACATATTCTGCCGGTGCGTCGTTGAGTAGGTAGGACCGCAGCTGCTTGAAAACTACTTCTCCATCTCCCTGATCTGCTCCTC
TCCAGTTGCGTCCATTGTTCTTCCGCTGTTTATCTGCTGAGTAATCGGACTGTCGTTTCCGCTGCGGCGACAGTTTTCTTGCGCTCTGCTTGGTCGGGAC
AGCTGTCTTCTTCTCCCTAGCCGCTGAGCTCTTGTCAGCTTTTCCCACCGTAGTCCACTGGATCTCTGTGGCAGCTTTTTGCTTCTGCCGTGTCGACGCC
GTTTTACCTTCGGCTTGTCCGCCATAATTGTTGTCGACTTGCTTCAGTCCGCTTTTGACACCCATCGCATTATCCCCGATGCCCTGCGCTTCTAATCGCT
TGCCTGAGCCGTCTACCACGATCGACTCCATGCTCCCCCGTTCCTTGGTCATGTCGTCTCCGTGCTTGCGTCCTTCCAGTTTTATCTGAAAGATTGTATA
CCGGGGGGTTACGCGTCCTTCCAAACGCCCCCCGTAAGCTGTTCTCCGCCGATCTGATCCCGAGTCCGGAGAGTCTCGTTCGCCAGCCGGCAAGTTGGGA
AGTGGTTTGTTCTTAATCTAGGCGGTCAACTCGTTCGAGTAGAGAACACCTCACCCGCCTAAATCGAGACCAGCACCGACACCTCGTGTCGTCAATGCGA
ATGTCGGCCAGTGTCCTTTTAGTCATTGCTGGTTTTCGCGACGTGATCTCGTCATTTGTCCTGCCCCATATGCGGCTGGAATGCCGAGTCGATCACTACT
GGTCACGTAAAGTCTTGTTCGCTGCACGACGTATCCTTTCGCCTCCATGAAGCTAACAACGATGCCGCTTATCCTTGCTTGGAGGGATCATTCGCAGTTT
TCACGCCTCGTTCACACGTCGCTCCAAGCCACAAGTGCGATGGTTCTTCAGACAGCACTGCTCTTCGCTGGTGCATGCGTTGCGTGCTTGTTTGACTGCA
CCGCGGGGTTGACCAAGGGGCACGACCTCTCCTCCGTGGGGCTCATGGAAACTGAGCAAGGCGCCAACTGGATCTCCACCTCGGGTAACACTACCACGAT
CGAGTCCATCCTAAGCGGAGGAGGCATGGACACCGTTCGGCTTCGGTATTTATTCACCTGAAAACTACTTCGGTAAGTACCAGCTACTAATCCTGTGAAT
GGTTCTGTACAGCATCTGGACGGACGGCGAGTACGATCTGGACTACACGTTGGCGCTGGCCCAGCGATTCTCCAAGGCCGGGTACAAGATCTACTTGGAC
ATGCACTTCTCCGACACCTGGGCCGACCCAACCGACCAAGCCATCCCTTCGTCATGGGACGACAGCTCGGTCACAACTCTTGCCGCTGATCTGCAGGCCT
ACGTGACGTCGACACTGAAGTCCTTCACGGACGGCGGAGTCGACCTCGACATCTTGTCGTTGGGCAACGAAATCACCGACGGATTCCTCTTCCCGACCGG
TCAAATCAACAATGACGACTTCAGTGCCTTTGCTACGCTGTGGAAGGCTGCACGGCAGGGCGTGACAGACGCTGTATCGGCCGGCACGACCCAGCCCAAG
GTGATGATCCACCTCGATAATGGCTGGAAGTACGAGACCGTGTCGTGGTTCTTCGACGGTCTTTTCGCGGAGGGCACCGTGACTACCGACGACGTGGACG
TGTTTGGCTTCTCATTCTACCCGTACTACAGCACGGACGCTACCATCGACGCCCTCACGTCTTCTCTGACTCAGTTGGCCAATTCGTACAGCAAGCCGAT
CTACGTGGCCGAGACGGACTGGCCGACGGAGTGCTCGAGCGTCACACTGAGTGGTGACTACCCAGTGAGCGCCAAGGGCCAACGCGAGTGGGTGATCGCC
ATCATGGACGTCCTCGAGAGCTTGCCCAGCAGTTTGGGCGCTGGTATTTTCTACTGGGAACCAGCATATCTGACGGTGGCAGGTCTCGGAAGTTCTTGCG
AATCGGCGCTGCTTTTTAGCGTCAATTGGGACAACTGGCCGGAGACGTACGCGACTGCGCTTTCGTCGATCAACATGTTCTCGTGAGCCTAGGAAAGATT
GATGCAGATGTATGTCGAGAAGGTGTCCATTATCACCTTGTTGCGTACAGTTCAGCGGGAAATGTAAAGTCTCCGTTTGTTTAGTCTCCGAATGCACGTG
TCAGTGTCAAGGATTGCCTTGGCACCAGCTGCACAAGCAGCAAGAGATCACGCTAGGATGGGGGCTCGCTGTTGGGAGAATAATCTCTTCAACATGTTGA
AGGATCTGTCCTTGTAGAAGCACCTATCTCGTTGTTCGTTCCTAAATCAACTTTTTGGTCGCCGGACTGCACTGGACCTGCTCGTCATTCTCCAATTCCT
ACCCCAGGCAATCAGTTCGAGTAGACAAGTAGTGGGAACATGGTCGTCGGAAGGACGCTGCTTTGGGTTGGTGTGTGTGCGACAGCTCTGCTCAATGGAG
TGCAAGCGTTGACCAAGGGCCATGATCTATCGTCTGCTGCCGTCATGGAGAAGGAGCAAGGCACTGTTTGGTACACTACCGCGGGCAAGGAGGCAGCAAT
CGAAGAGATTCTTGGCGCTGGAGGCATGGACAGCGTGCGACTTCGGTGCGTACTAGTCCAGCTACACTATCTCAATATATTCACCTTACTGAAGGAGCTT
GGTACTAACTAACAAATTGATACTTTACAGACTTTGGACAGGAAAAGAATACGGCTTGGACTACACCCTAGCACAAGCTCAGCGATTCTCCAAAGCGGGA
TTCAAGATTTTCCTAGACTTGCACTTCTCCGACACCTGGGCGCAGCCGAGTGACCAGCAGACGCCGTCGGCTTGGGACGCTTCGTCCGTGGAGACGTTGG
CGGCGGCATGTCGCGACCACGTCAGCTCCACGCTGAAGGCGTTCACCGATGGCGGAGTGGGCTGGACCTCTTGTCTATCGGCAACGAGATCACCGACGGA
TTTCTCTACCCGACTGGTAAGATCAGCAACGACGATTTCGGACCTTTTGCCAAGTTGTGGAAGGCGGCACGGGAAGGCGTTGCGGATGCCGTGACGGCTG
GAAGTACACAGCCGAAAGTGATGATTCACATCGACAACGGCTGGAAGTACGAGACGGTGTCGTGGTTCTTCAAGGTCTGTTTGATGAAGGAACGGTGACC
ACCGACGACGTGGACGCATTTGGGTTCTCGTTCTACCCGTACTACAACACGGAGGCGACGCTGGACGCTCTCACATCGTCACTTACTCAAATGGCAAACA
CGTACAAGAAACCGATTTACGTGGCGGAGACGGACTGGCCTACGAACTGCACGAAGGTGACTCTGAGTGAGAAGTACCCAGTTAGTGCACAGGGTCAGCG
CGAGTGGGTGACAGCTATTGTGAATGTGTTGGAAGGTTTGCCGACGCGCTTGGTGCTGGTATTTTCTACTGGGAGCCGGGCTACATCAAGGTGCCGGGTC
TGGGCAGCTCGTGCGAGTCAAACCTTCTGTTCGATGTGAACTGGGATAATTGGCCGGAGACGTACGCGACGGCACTTACGTCGGTGGACATGTTTAACTG
AGGGTTTGCCTAATCTTCTCTTTGAAGATTATGCACATTTTTGCTTACAGATCTAGTGCTGTTAAAACTTGAGTAAATTTCCTAAATGTTTATGGTTTCA
TGCCGGAAACCATAGGGTAAAAAACAAATGGCCTTTTTTTTTTTAATGAACCAAACGCTACTATTATTATCAGTATCTCTTGCTTCTGAACATGGAAAAT
GCAGTTGTGAGTTTACTTTTGATTAGGCTTTTGACAAAGTGATTCCTGTTAGTCAAAAAGCGCGCAGTATCTCGATGGTAAGGCAAATGTATATGTTAAT
ACACTCAGTGTTACATGAGCACATTTTAATTGCTATATGAACTCGCTTGTTTTCGGAGATATTTGACATAATCCCGAGCTGTTAGTACAGAGCTCAAAAA
AGAAAACTACAATATAATAACGATAGTGTTAGAAATTATCGCATAAATTCAGTGTATGAATAAACAGAAAGCGGGCGCCATTAGACATTTTTGCTTACCT
TTTACAACTTGATAGGCTCACAAATATGTCTGGGGTACCTCCTGTTGGACGAACGGGTCAACTAGCGACGTTGCTGTCAGAGTTGAACCGCCTGTCGATG
AGGACCGTCTCTTTAGTTGTAGGAGTTTCCGAGGCTGGCAGCAGGACCCTGCATTCTAACACTCAATTCATCCTACATCTTTCCTCACCACGAGAACTTC
TCCAAGTTCCGACAGATCGCGCCTGTTGAACTGCCCACCACGACTGCAACAACGAGCAACGCCCCCACCCTCAACAAGGACGTTTTGCAAAACGAGGCAC
AGTCAAGAAATTAGAGATGTCAACTCCAAATTTTGGCTGTGTCTGAAACCGGCATATAACACGGTTGGATGCGCTGATCGCCAGAGAACAGCTCTGCTGG
AGGAATAAATCCATTCAGTGAGATTCAATCCTATTTGTCGCCGGGTAAGTAGATTGGTGTTACTACGTATAAGTAGATTGACGCTAAACCTACTTACTCA
GACTTGACGACGCGAATCTGACTCGGAAAACATTAAGAGAGTTGTCATAAGATTTAAAGATGGCATTATCGGCAAACAAGCACTCTAAGGAGATCCTTCA
TAAACAAACCAACGATGGCAACATCGCGCGTAAGCTGCCCCCTGTGCTAGCATAACCTCGCCGCAACTAGCATACGGGCTCATATCGGCCAGCTGGCATG
CGTGGAGCGTACTTGCCCAGAGCTGAGAGCTAGACCCCTTGTGCTTGCCCAGCTAGCCAAGAAGGACTATGATCGTCGCTAAGCTCACGCCTGTCGCGAC
GGCATTCAGGATATGGGCGTCAGACTGCTCGAGTGGGCAGCGGTCACCTCTGTCGAGGTTGATCAAGGCATCCCAATGCAAGAGACACCAAATGCCCACC
ATGTATTCGATACATTTGTCCCAGCTAGCCCTGTTCCATTTGCATCAAGAGAGGTGGAAATTATTGACATGACAGACGATGACAAGGTCGATGAAAGTAC
CTGCTCAATTTGCCAGTACGTATCGGTGGATCCGGTGCCACCGCGTTCGTCCTGTCATGCAATGTGCTCCGAGTGTGTGTTTGCTCTCGTCGTCCATTGT
ATTACAGAGGATGTTAACCCGCACTACCCCATTTGCCGCGTCATTGTGCTTGTAAAGGCATTTGTTTAAACAATGTTGTATTTCAATATATGAAGCGGTT
GGCCGGACCCCGGGTTCCCGCAACAGAAACCGAAAAAGGCGGGAATTATTTATTTAATTTTGGACCTGCGGTCGCGGCGACCGAGTGCAAAACTACATCG
TTTAGGAAACCAATAGCGCATTGGGGCCGTGTCGAGCAGCAAGTCGACCGTGGACCCCGTGTGGAGAAGCAAGACGCCCTTGTTTCAAGAGCATCAAGCG
AATATGACGCAACGGCGCGGAGGAGGGTTGCGGTCAACAATCCCGCAACGTAAACGGAAGAAGGGTTCTGACCGACAAGCTGCCGCATACCTTCGAGCAG
TAGAGCTCCTGGGTGCTGACACCGTGAAGCAGATAAGACAGGATTGGGAATCTTGGGACACAAACTTCGGTGGCAGGGAGTGGCAACAATCTGAAGGCGT
GGTGCTGCAGTTGATACAACAGGGACTATCCGAGCGCGTGATCCGATCCATTATTCCAGTCGGTGGGAGCCGTATTTCGAGGCTGAGAAAGGTCCTTAAG
GATGGAATTGACACCTTACACACAAGAAGATTGCCAATCAAGCCATGGCACGCATTTAGTGAGCTGGACCTGGATGCTTTTAAGACTTACTGCGCATCTT
GGACACTCGAGGATGGTTTTCCCTGCGCCCACCGCCGCCCACGTCAGTACTTCACAGAGCCGAAACTGACGTGGGTTGTCGTGCATTCTCGGTATGTGGA
TGATATCTTGCGCGCCCATCCCGACGCCAGAACGCTAAGCTATTCACGCTTCACTCAGTATGTGCACTTTTACTACCCTGGCGTCCGCTTAACACGAACT
GCAGAAGACGTGTGTGATTGTTGTATTCGAAATTGACCAAGGTGTCTGCACGGCGCGCAAAACGGTAAGTACGCCAGATGACCAATCGATCATATTCTCG
ATGATACCGCACAGCAACATCGAGTCTGTCCGCAAAGCAGTGTTGGCTGAGCTTTTTGGAGCAAACATCAAAAGTGTTTGGGAAGCATCCGTTCGCGGCG
TCCAGCTCCCTCGCCATCCAACCAAAGAACTATCCGCAAAGAAAATCAAGTCATTGTCAGCTAAGTATTTCTCAATACCACAAGAGCACCTCGGCTACTA
TCCTGCCGTGCCTGAAGCGATCCTAAACGCCCCAGAGATCAATACCGAGCACACCGAAACAGGAGACCCCAACACTGATGCCACCGCGGGAAAACACAAG
TCTGGTCGACCTCACAAGAAGAAAGTGAAGCTGCGAGCTAAACAGCCTTCCATTCTGCAGTTCTTCAGCTCTGCTGCGAAGTAGAAAGATAAAGTAGTTT
GACCTTTTTTTAAAAGAAAAAAATACCATTGCATTTTACCAAATACCGGTTGTTTTGCCAGAACCGGGGTCCTTGTGGGACCCCGGGTGCCCGCCAAACG
CTTCATATATACTATAAACTGACGGGATAGAAACCATATCATTGAATACAGAAACAGCAAATCACGTCATCAGCTTTTCAAACTTATTGTACTCGTACGA
CTGACCTTGTACAATTTTACACTGAAATCGATGTGTAATCGTGGCCTAAACTTGTATGATTTTACACAAAATCCGAAAGATATAATTATCATAAACATAC
AATTGCACTTGCATCATTTAATAATATAACCTAGAGGGTTGGTTAGAAAAAATGTATAATGTATAAACGTACCGAATTTCCCAACCAGTTGGCTGTCTCA
GACAAATTGAATGCCACTTCGTCGTATAATGGTTGATTGTACATTTCGTCAAACGCGTACGTAACGCAGTGTGCTTTATCGATTCCGTTCAAGTACTCAG
TAGCTAGTGGACGTGTGTCAGATAGTTTAGAGTTGTAGAACTTGTAGTTTTCACATTCACTCCGCACCATCTGAAACACGAACGCCTGCTCCGGAGGCGA
CAAGGTTGACCCCTTCTTCTCAGCGATCGCTATGATGTTTTGGTCACAGAATCGATGGCTAGATTCCAGGTACAGCTGACTCACAGATGAGATAAATCCG
TTTTGGTGATCAGAAACAAAGATGAGTTTCCATCCATGACCAGCGGCCTCCACCGCATATTTCATGTGCGACAGGAACCAACTCCAATTCATATAGTCTT
CTTGCTCCACCAGAGCAAGACCAAATACAAGAATATGGCTGGCGAGGGGGTTTTGTAGTCACGAGAAGAAACACACCACACTTGTTCATGTCACCCTTTA
AATAGGTCAAGGATATGTTTGTAATATTGCATCGCCTGCAAACAAGCACCAGGAAAGAAACAGGCTATTGAAACCGCCATGGTCGTGCTTCTCCAAACCA
AAACTCGATTTGGCGTTAGCCTCCGTAACCATGAGCAGATACGCTTCCAATATCTGGTAGCTCTCAGTGATATCCTCGCGTAAAGATCCAAGAAGATCTC
GTTTCAACTTCGACACCATCGGGCGGTTTGTAGTGATTCGTTGGATTTTTAGAAAATCCAAAATGGCGTCACCTGCGACTGAAGCCCAGGTATTGCTGTA
AGCAGGAAGTATTTCTCGCTTTAGGATGCCGCGTCGTCCCGTATGGCACATGGCGCTGACATTGCTGTTGCGTATCAGCCACAAGGTCGTCTTCAACAAA
CGTGTCTTTTTGAAAACCAGCATGCATGCGCCAGATTCATCTACGTGACCTACCACTGATTGCGTAACCCATACACCGCGATTAAGATTGGACATTGCTC
GACACTCCCTAGAATCAGCGGCTGTTACCCTCCAGGCGCTTGCACGCGTAGTTCGCGTTTCCTTCCCGGGTGGCCTTTAACCAGCTATTGTTCGTCACAC
GAAGGGAAAAGCCCTGTCGACGAGCATACTCCCGACAACGAAGTTGTACATCCTTTCTTGATCAAATTAGCACTTTTACCAAAACAAGTGAACAGTGTGA
CAAATGTGTTAATAATGAGAACGAAGTTTTTCGTTAAAATGCTTTTCCCACAAAGTGAAATTTCATGCATTCGTGATTCTAACCAAGTGAACATCTAGCA
CCAACCATTGTATTTGAGCCGCAAGGCACAACCGCTCTCAGTTCCAATCCGCCATACCTTCCTCCGACAAACTACCAGCAAACGCCAACATGAACGTGCG
TGGAACTAAGGCCCGCATAGTGTGTGCGCACAAGGACGGCGAGAATTGGCGCGCCGTCGCCGCTCACAATGGCATCCCCTATATCACGGCTCGGTGTGCG
GTTCTCGGCGAAGACGCCGATCCCAAAAGATACACGGCGGCGTGCGAACGGCGCGTGTCAAAATGTCCGTCGAGGTCATGAGCAAACTGGAGGAGTATCT
CGACGAAGACAGCCGGCACACCTGCGAGCAGATGGGTGACAAGTTGTGTAGCGACATGGACGTGTCCGTGAGCATATTCTCCGCTCACCATGCTCTTCGG
GATATGGTCTACAGCCTTAAAAGCTGCGCATTAAGAAGATTTCAATGAACAAGACGGAGAATAAGATCAAGATGATGGCTTTTGTGGAGAAGTTGAAGAA
GTACAGACCTCTTCACTGCGGTATTGGCGACAGAGGAGTACTGTATACAGGCACCGATGAACAAGATTGTCGTCGTGACCAACAATGCGTCACATCACGG
TGAGGTGAAGACGTTGGCGAGGGAGATGCTTGTGGTGGACGGCATCATGAACAGCAACAAGCTGGTCGTGCTACGCCTCGCCCCGTACAGCCCCATGCTT
ATCCCAATTGAGGGCAGCTGCAACGTGTTCAAGGCGAAGATGCACCGTTACATTGCTGAACAGAAAGAAGGGTTTCTAGTGAGGGGTGAGTACAGCACGT
TTTCCGCGCATTGTTAGGCTCTCATAAAGGAGGCTGCTGAAGTAGCCAAGTTTATAATTACTCGTCGTCTGGTTTGTCACATGGAGCGCCATTGTCTTAA
GGCGTCGTTTGCCGCCGGCAGAGGCGAGGACATGGAGCTGGGCAAGTAGCTGGGTGTACCCCTATTCACTTGGGTGAGAGCTCGACTACAGTAGCTCGAT
TTTCAAGTTGTTAAAAATAGCTTTTTCTATTCTAATTATTTTGTGCAAAAAATTGGATGCTCACTTGCTTTGGTAAAAGTGCCAACTCAGTTATCAAATG
GTGTGGTGCTGACCGTGTCTCAAACATTATGTCCGCCAAGTTCCTTCCGTGGTCTGTGACTTGGCCATATATGAAAGAGTGTGTACGATTCATCTGGAAA
TCGACATCACTGTGAAGGAGACCCATTCCTCGGAGATCTTCGATGCTCGCAGTCTCGACGTGGCTAGTAGAAGTAACTAGAATCGTTATATTGTCTCACG
CTGGTACGAAGGTTGGACATGGTAGGTGGAGGGACAGCGGAGAGTTCTGTCGAATAGCAGAATGAGGCAAGGAATGTGACAGCAACGTGTGTGGTGGGCT
CACGGTTGCGCAACAAGTGGATTCTTCTAGGTAGTGTTTTCGTAGCAGCAGCAAAAAACACAGGAGTCTTGACACCTCTGCCAAAGAGTCGTTTAATGCG
ATGCTTTAGTAGGGCATAATATATGTAGGTACCAATTGAAAACGGACAAACTTTAAAAGTGTACGAGTCGAACGATCTCGCAAATTTTAATTTATTTTAT
GAGTCGCACGATTCTACAAAAGATAATTTTAATCGAGTCGTAAAAAGTCGTAAATTTGAATTAATAATTAGGAAAATTAAGGATAAATAAGGTTTGGCTT
CAATCTACTGATAAGCAGTATTAATAACACCAATCTACTTACCCGGCGACAAGTAGGGCTGAATCTCATTGAATAGATTAGTTCCTCGCTCTGCTGTGAC
GTCAACACAGAGATCAAAGGCACCCTAGCTCGAGAGTTACTATCCGATGCCATAGATCTCGGGAAGCTCCTCGATCTCCAGAGTTAACTTGCCTTGCTTT
TAATTAACGCAATCAGCCGTGTTGGCAGCCGGCTGTTCACTTCGCGGTTTCGGTTGGTAATGGCAGTCTCCATTGGCAGCCTTGTGGTGCTACCACTGGT
GGTGATGGCCACAAGGGCTAATTCCGTCATGTCCTCTGGGTAAAATCTTTCCTCGGCATGAGAAAATAGACGAATGTGAGGCCTTCATGTTTCCTTCAAA
TGACATTGGCGCTTGACCATGGTATTTGGCGCCCAGATTTAGGGCCGCTTTTTTGCAATTCAGAGACCCCGTAATCTTGATTTCAGTATGGTCTGCCCTA
TTCACTGAGTACGGTTCACCAGATTTTGAGATGGTGAAAAGTGTCAAGTCTCCTCTGCAGCCTGGAGGACATGTGTGCGCGCACCGAAGGTGAAATGGTT
CTACGCTACGTGTAAGCTTATCCAGTTTAGGTTGGGTGCAATCAATTAGATCACATCTGCAGGGGAAACAGGAGCCTAGTGGCGAGTGATATAATACTTT
CGCCGTGCTTATTTGGCACTTCGCTGCTCGTTTTCTTAATCTCCGCCCTCTGGTCGACGACTAGTGGTCGTACATTCGCCTCTGGTGCACCGGATCTGCT
CGCTTATGTCACGCTTCTCCATCCTTGACAACCACTTCGATTTGTCAAGTGAACGGAGGAGGGAACTATGCTCGCTCGGAGAACGCTGCTGTGGTTGGGA
GCTTTTGCGGCACCTCTGCTCAATGGAGTGCAAGCGTTGACCAAGGGTCATGATCTATCGTCTGCTGCCGTCATGGAGAAGGAGCAAGGCACTGTTTGGT
ACTCCACAAAGGGCAAGGAGATGGCAATCGAAGAGATTCTTGGCGCTGGAGGCATGGACAGCGTGCGACTTCGGTGCGTACTAGTCCAGCTACACTATCT
CAATATATTCACCTTACTGAAGGAGCTTGGTACTAACTAACAAATTGATACTTTACAGACTTTGGACAGGAAAAGAGTACGGCTTGGACTACACCCTAGC
ACAAGCTCAGCGATTCTCCAAAGCGGGATTCAAGATTTTCCTAGACTTGCACTTCTCCGACACCTGGGCGCAGCCGAGTGACCAGCAGACGCCGTCGGCT
TGGGACGCTTCGTCCGTGGAGACGTTGGCGGCGGCATGTCGCGACCACGTCAGCTCCACGCTGAAGGCGTTCACCGATGGCGGAGTGGAGCTGGACCTCT
TGTCTATCGGCAACGAGATCACCGACGGATTTCTCTACCCGACTGGTAAGATCAGCAACGACGATTTCGGACCTTTTGCCAAGCTGTGGAAGGCGGCACG
GGAAGGCGTTGCGGATGCCGTGACGGCTGGAAGTACACAGCCGAAAGTGATGATTCACATCGACAACGGCTGGAAGTACGAGACGGTGTCGTGGTTCTTC
AAGGGTCTGTTTGATGAAGGAACGGTGACCACCGACGACGTGGACGCATTTGGGTTCTCGTTCTACCCGTACTACAACACGGAGGCGACGCTGGACGCTC
TCACATCGTCACTTACTCAAATGGCAAACACGTACAAGAAACCGATTTACGTGGCGGAGACGGACTGGCCTACGAACTGCACGAAGGTGACTCTGAGTGA
GAAGTACCCAGTTAGTGCACGGGGTCAGCGCGAGTGGGTGATGGCTATCATAGACGTTCTCGAAGGTTTGCCGAACGCACTTGGTGCTGGTATTTTCTAC
TGGGAGCCGGGCTACATCAAGGTGCCGGGTCTGGGCAGCTCGTGCGAGTCAAACCTTCTTTTCCACGTGAACTGGGACAATTGGCCGGAGACGTACGCGA
ATGCACTTTCATCCGTTTACATGTTTGGCGACAAGGGCTCTTCCCAAGGCAACAGCTCTGCTCAACAGACCAGCCCCACTCAAGAAACCCAGACCGATCC
TTCGCAGCAAATGCAATCCAGCTCCTCGCAGCAGATGCGATCCAGCTCTTCAGAACAGGAAAACGAAGATACTGAGCAGCAAACGGCAGCTTCGGAAAGT
ACCACGCAGCAACAGTAGCCATCAGAAAATATCCTGAAAATATCAACAGCTCCCATCGAGCAAAGCTTTGATTGAAAACTTGAACCACGAGACAGAGCGA
AATACAGTGAAGCAAGCCCGCTTTCAAATACATGTAGTAAACAATGGAGGTGCCGCCCAGCTTTCATCCTCGTGCAACCACAGCCTTCGGGCACTCCGGG
GCTCGTCTGCAGTGCGTTCGGCTTTGGCACGGCGTAGAGCGTGGAAGAGTGCTACTGAAAGCGCTGACGAAACCAATGCGTGAACACTTGCAGTGACGAG
TGCAAGGACCACATAGCTGCTTGATCTATGTTGTCGATATTTCCGAGCTCAGGAATTCACGTAGGAGGTCGATCCGAGACTTCTGTTAACGTGGGGTGCT
ACCTGGGAAGCACACACCCAAGGGGACATATGTCAGGTTAGTGACGCGTAACACCGCACTAGACCTACTACAGCAAGAACCCTTGAGGTGGGATACATGT
ACTCCACCAGTGAACTTCAACCGGAAGACCTCAGCCGAGACTTCAACGGAGCAGCAATCTGGTTAAAGACGACACTGCCTGCAGGCTTGATGCACTGTTC
GAATGAGTCAGCTACTACAGTCATACTTCAAGGATCAGACTGAGCAACTACACTACGAGCTTACGTGGTATTTTTGCAGCTGAATGTAGGGATCCCTGCT
GCTGCCTCCCTCCTCACAAACACCAGTGCACTAGTCGTGCACTCCATTCCAAGAGCTTTTCGAGAAGCTCATTCCCGATTTTCAAGTCTGCTCCGCAAGT
CCAACAGCAAAACAACCAAGGAGCCGAATGTTTTTCAAGTCGGCACTTCTCGTTGCCGGTGCATGCGTTGCGAGCGTGTTCACCACCGCTGCAGCGCTGA
CCAAGGGCCACGACTTGTCTTCCGTTGCTTTGATGGAAACAACCCAAGGTGCCCAGTGGATCTCCACCTCTGGCAAGACAACCACGATCGAATCCATCCT
CGGGGATGCAGGCATGGACTCTGTTCGACTCCGGTACGTCCACTTGTCAGCATTAACCTACACCACTCACCTCTCTGACGGTATAACGCAGCATTTGGAC
GGACGGTGACTATGACCTGGACTACACGCTGGCGTTGGCCAAGCGCTTCTCCAAGGCAGGATACAAGATCTACCTGGACATGCACTTCTCCGACACGTGG
GCAGATCCGCACAAGCAAGGCATCCCTGCAGCATGGGACAAAACGTCGGTCACGACGCTGGCTGCTGCTCTGCGATCCTACATGAAGTCGACGTTGAAGT
CCTTCACGGACGGCGGTGTCACCATCGACATCCTGTCGCTGGGCAATGAGATCACAGTCGGATTCCTCTGGCCGACGGGCAAGATCACCAACAGCAATTA
CGGTAACTTTGCTACGTTGTGGAAGGCTGCGCGTCAAGGAGTGACGGATGCTGTAGCGGCCGGTACCAAGAAACCCAAGGTCATGATCCACATTGACAAC
GGATGGGACTACAGACAACGACACAAATACCCGGGCAACACAAAACCCGGGAACACGAGAAAAATACATTTATTTTTACCAATCAAATTACTAGAAAAAT
ATATATATTTACCAATCATGAAAAAATAAAAATTGGATGGCCAGCAGCTAAAACGCCGAGGCACCGGCCAGTCCTGCCACTGCAACAAATGCCGCGGAAG
CAACATAGCTACACCATGAAGGTGAAGCTGGTGGCGCTGGATTCCATCGAGCGGATCGGCTTGACCGCGACGGTCGCCGAGCTCCGGTACCCCCATGGGA
CCGTGGACGGGTGGTGGCGGGCGCGTGACAAGCTCCGAGCGTACGCTGGAAACAAGCTGTCCAAGACGATAAATGGGCAGGGGCGCAAGGAAAGCTTTCT
TTCACCCCAGCCCTCGTCACCTTCATGAAGGACACTCGCCGGGACGAAGAGGTACGTTTTATCATATTTTACAATTTTTGCATTATTTCTAACGTTAAGC
GTCTATGTAGTGGCTCACTACGTCGATAATGATAGGTTTTATAGCGGAGAACTATGAAGAATGGCTAGAACAATACGAAGAAGGCAAAACGTCGCCTCAG
AGCTGCCGAAAGGCGCTGGAGAGACTACTGCAGAGAACAGAAAATCGGTAAAAACTTTTGTCTCAGTACATTGAACATTATATCTATACTAAATGTGTCA
TGTACTGTCATTATGTACTGTTTTTAGATATGGATTTTCGACACAAAAGGCTCAAGAAACGAAGTTGCCGTGCTTAGATCTGATGCAGATTAAGCAGGAC
TTTGCTATTGAGTTTTGGTCTGTCTACAGCTCCTACTAACCTTCTGAAATTCACAATATGAGTTTTCAGAGGAGCTAGTAATTTGTAGCTTTCAGACAGC
AATTCCTAGGATCGAGTCAATGACAGTTTAAGCGATTAATAAAATGGTGTTTTTTATATTTTCTTTGAAGTTTGTATTTACCAATCAGAGCATTGGTCTG
TGGCCTGTTTGGCCCGGGTATTTGTGTCGCTGTCTGTACGCCTACGTGTCCGCGTTCTTCACCGGGCTCTTCGCTACTGGTACGGTGACTACCAGCGACG
TGGACGTGTTCGGCTTCTCGTTCTACCCGTTCTACGACTCGAAAGCTACGATCAGTTCACTCAAGTCTTCGCTGACTCAAATCGCCAACAAATACCAAAA
GCCGATCTACGTCGCCGAGACGGACTGGCCGACGGAGTGCTCCACTGTCACGCTGAGCGCTAGTTACCCAGTGAACGCCAAGGGCCAACGCCAGTGGGTA
GCTGCTATCATCGACGTCCTGAACGGTTTGCCAAGCAGCTTGGGCGCCGGTATTTTCTACTGGGAGCCGGCGTACCTGACGGTGGCGGGTCTAGGCAGCT
CTTGCCAATCGGCTCTACTCTTCAGCGTCAACTGGAATAACTGGCCGGTGACCTACGCGACGGCGCTCTCGTCTGTCTACATGTTCAGTTGACCAACCGG
TTGACGGAGACCATAGCGTCTAGCCTGTTCTTTTGCAAAGTCGAAGAGTTTAGTTCTCTTCGAAGCCCAACTAAGCTTGATGCCTGCTCGTGGCGTGTCG
AACCACACTGTCTCCTTAGTGTTCCCTTTGAAACTGGGCAAATCGATCTCGAATTTGCCTTTGCTGCTGATCGAGTAGGTTGGCGACGAATGTGGCGTCT
CCACTTTGCCCCGGTTCACCCAGCCGCTCGAAGAAGATTGCACGCACCAGGTCGGTACTGAGACGGAGATCGCGCTCGATGTCAGCGCGCAGGCAACGAC
CGTTTTCTTGAATTGCTTCTTTTGAAGTTGCTCCATGGGTCCGTACAAAGTGCTGCAGTCTTGAAGATCTTCGTAACTTCGCTTTGTACCAGTCTGAACT
CGACCTGAAACGCGGCCATGAGGCGCCTCCGTACGCAGTTTTGGCCTCGGTGTGACCTCTGTCGAGACTTCTTCGGTACTCTCTTCACTCTCATCGGAGC
TAGAGCAATCACCGAACAACGTCTGGTCAATCCTTTTCTTGGGTTTTCCATCTTCCATGTCGGCTGGAACGCTGAAGATTTCGCCATTTTCTGGAGCTGG
GGCTGGCAAAGTGCATCCAGAGGAATCTACGCGCTGCATTTCGTCGAAAATGTCGTGGCTGATGTCTTCAAATTCTGCTGGGAGAGCGTACCAGTCTACA
CGCAAGCTTTGCTCGCTGTCTGAGAGCTGGAACCACGTTACGGGGGCGTGGCGCTCGTTGAAAGCTCGGATGAAGAGATACGAGGCGGCAATGCGCTTCA
TTTTTCGCCAAGCGCTGAAGGTCGAGTGACTCCAGGGAGTGTATAGCGTCGCGGACTCGTCGTAGCCCTGAGCCATGAAAGCGCTGACCAAAGTGTTTGA
CTTCTTCATCACATGACTCCAAGACTGTACGAGAGATTTTACTTCGCACGGAGACCAACACGAACTGCACTTTGACGGGTGCTGAGCTTCTGTTTTGGGC
TTGGATGCAATCGCTTTCCGCACTTTTGCCCACTTGCGCACCGATTTCAGCTGGAGAAGCGTCTTGTAGGACGCCCGTGTAAGGTTCCAGCAGGTTTTCC
TGACTGACGTAGGCATCTCCACTCGGTTCCGTTCTTCTCTAGGCAGATCAAACCACAGGCGACCACCGGCCACTTGCTGAATCTCGTTGAAGCGGTTTAC
AACTTGTACGACCTTGTAGAGCTTGCAGCGCTGGCATCCGATACTGTCAGAAGTGCGACTTTTGTTGGTCCGCTGCGAGAGTTGTTCGGCAATGTGGCTG
TTAATGCCGCCTCCACTCTTCGTCCGCGAATGCATATACGCTGTAGGGTTAGATTCCAGCTCTCTCCACAGCTCAATCATTAGTGACACCTCTTTCTCGG
TCCATTCCGGGTGGAGGAAGCTCGGGTCGCTTCGATCAAAGACCCCCGCGGACTTCATCCTACTTGAGCAAGTGGTTTCCCCGCTTGAAAAAATAAAAAC
GAGAAAGGGAACGGCGTTGAACAACAACGTACGAGGTTCAATTCGAAAAGTATATTCCTAATGGAACGAAGATTGACTACACCTAGCACAGGTCCCCCCT
CTGCTGGTCCTCCGATCGGATCATTTTTTCTCGTGGTAACGCGGTCCAAGAAGCGCGCGGTTCTCAGCTTCTTCACGGGTCCGTTTCTCCATAAACTGAT
CAAACCGATCGCGGATCTGCTGCTGCTGCATGTTCAGTACCTTGGTCACGAAAGCGACGTCGCCGCTGCTCTCCGGGTCCTCAAACTGGTGGCTGATGAT
GGAGCGCAGCATCTCCGCGCTGCGTTGGATTTCGCTTTCAACGTCAGCACGCAACTTGCTCGCGGCTCGACGCATTTTCTTGTTCTGCAGCTCCATCATG
TTGTCGAGAAGAATATTGCAGTCGCGGTGCTTGCGTTTGGGCGGAAAGTCCAGCTCTGGCT