Description :
From Genome Similarity Track
Location :
Scaffold_26:55932- 57798
Transcript NameFunction/comments
g4261.t1XP_008912071.1 TKL/DRK protein kinase [Phytophthora parasitica INRA-310

Sequence
1866 bases(100 bases per row)
CCTCCGCCGCGTTCGTCTTCAATGGTTCGAACTCCGACATTGCGCAGCAGCTCTACATCCGCCACCAGGCCGGCGACTCCGGAGACCAAGTCACCTTGAC
GTCGGTTCCGACTGCAGTGACCGACCGCCTCGACCCGCTCAACGTCGACTTCGCCACGCTCCCCGGCCTCGTACAGCGCGCGGTGCTCTGGGACACAGGC
TTCGTCATCGCTCCGGGCAACGTCCCAGTGCAGGTCTACCCCAAGAACAACCGCAGCATGGCCGACATCGCCGTGCAAAAGTACGAGGTCTTCAACGTGC
AGTGCACGGTCAAGAACTGCTCCCAGCCGAGCGGCGAGGACGGCTACTACACCCGCTACTGCACGGGGTATCAGATGCTCAACACGTCGCACTGCGTGAT
CGACGTCTTCGAAGACTCGGGCGCCGGCACTTACCTGGGCAACATGTGGGCGGCGGGCGGGGACCCCGACACGGTGCCCGAGATCGAAGTGCGCGATCAC
TCGTGGTCCGACTACTTCAACGACGTCATGACCGACTTCTCCGTCTACGTGGTGCATACCATGTCCAGCACGGACGAACCGGCGTGGGATACGTGTCCCG
CAGACAACGGGTACACGTCCCCGCTGAGTGTGCCGTGCCACCGGAGGGACCAGTTCTCGGACGAGTTCATGGCTGCCAACACGACGGTGCCGACGGGGAG
TGCCTGGGTCACGACGTGGCTGGAAGACGAGTTCGCTGAGGATTCCGGCTTCAACAAGGTCTTGCTGGTCCCGATCATACTGGGTATCCTCGTGGTGCTT
GGTGGTGGTCTCGGGTGGTTCTGCTGGAAGCGGCGAGCGAAGACGAACGCCGACAAGTCGGCGACTGCAGCGTATGAGCTGGAAGGCGAGCACTACGTGG
GTGTGGCTACTCCGGAGTTGTCTCTCCACCCCATGACCACGACGCAGGGCTCCACCATCTCCAGTCACTACGAGAGTGCCGGCTCCAACAAGACGCTCAA
GGTTTTGCTCGGTAGCGAGCACCTCCGGGGCAAGCGGATCCCGTTCGAGAGTCTGAGCTTCGAGCGCGCGTTGTCCAAGGGTGCGTCTGGAGAAGTCTGG
GTGTGTGCGTACAACGGCCAGAAAGTGGCAGTCAAGAGACTGCTGCAGAGCAAGGAGCAGAAGGCCGAGAACGTCCAGGCGTTTGCCGAGGAGATCGACC
TCAGCGCCAGCCTTGTGCACCCGCACATTGTCGAGTTCATCGGTGTGGCCTGGAACAGTCTCAACAACTTGGTCTTGGTACTCGAGTTCTTCCCCCGGGG
GAACCTGCAGAGCTACCTGCAACAGCACGGAGACCTGCTGTCCTGGGCGCGGGACAAGATCCACATGGCCATTGGCGTTGCTCAAGCGCTCGAGTACTTG
CACGCTCGCACGCCGCCTCTCATCCACCGCGACCTCAAGTCGAACAACATCCTGCTGACAGACAAGTTGGAGCCCAAACTCATCGACTTTGGCGTGAGTC
GTGGCACAGTAGACAACACGATGACAGCGGGTGTCGGCACGCCGTACTGGACGGCCCCAGAGATCCTGGAAGGCAAGCGATACACGGAGCAGGCGGACAT
TTACTCGTTCGGCGTGGTGCTGACGGAGCTGGACACGTGCAAGATCCCCTACTCCAATGCTGCGACGGAAGGCGGAGGCAAGCCCAAGCCGTTCCAGATC
CTGCAGGACGTGATGGCGGGTAAGTTGCGCCCCAGTTTCTCCGAGGACTGCCCCCCGCGGATCAAGCGGGTTGGATTGCGGTGTCTAGCCGTCGATCCGG
CCGGTCGCCCGACGGCCCACGAGTTGATTCAGGAGCTCGAGGGCAGTGGAAACTAAGTGTAGAAAG