Description :
From Genome Similarity Track
Location :
contig_42:559315- 578776
Transcript NameFunction/comments
g9582.t1hypothetical protein
g9583.t1POM61633.1 putative beta-galactosidase [Phytophthora palmivora var. palmivora
g9584.t1hypothetical protein
g9585.t1XP_009524505.1 hypothetical protein PHYSODRAFT_329696 [Phytophthora sojae

Sequence
19461 bases(100 bases per row)
CATTATCTTCGGCAGTGTCCACCTGTGTCATTTCGTGGTCCGCGTTTGCGTCACTCATCGACGCACTATCCATTGCTGCTTCCTTCTCCATAATGTTCCC
CGATACGCCGTCGAGTTTGTCGCCACTTGGCGCTTTGTAGTAGTGATGCATGAACTGCTGCATAGCTCGGCGCCCCTCTTTACGCGACTGTCTTGTGCTG
GTGCGAGTCGGCGACCGTGATCTCGCCTTCTCTTCTGTTGTGCACGTCTTCATCAATTTCTGCATAGTTTGGATTTCCTCCGTCCCTGTTGCCAATTCCC
ATTCGGCTGGCGGGTGCCTCTTTGGTGAGGTGGATCGCAATTCACTGGTACATTGGCGGTCTTATTCTTTCCCCCGGTGAAGGCTCTGAAGAATTATCCC
GCTCCTCGATGTTGTTTCCTTCCTCGCGAGGGGTTCATCTGATGTCCCAACTTTCTTTACGTTGGATCCCAACCTGTTGCTGTTAGAATCCTCCTCTCTG
TGGTCCTTCCCCGTGGCGATATACTCCTTGTCGAGACTGCGGTCCTGTTCTTAGTTGTTTCTTCGTAGGTTCCCCCGTCCGCTTCATGCACCTCCTCCAC
CATCTCGATATCTCCAATATGTTGTTCGTCAGTTGATGGTGAGTCAGCTTCTGGGTCAACTTGCGCGTTTTTGTATTTTAAGTATTTGTTACCAGTGTTG
CCGTCATCCTCCTCCGCTATCTGTTTCGCATCACTGTGCACTTTGTTTTTGTTATCATTTTGCGTGTTGTGAGCTGCTGCTTCCTCATTCTTAATGCTGT
GTAATTGTTCCCATTCCCGCGGTAGCGTTGGTCCCTCTGCTAGCACCGACGTAGGTTGGTGTTGGGCCTCCTTCCTTTGTCCCCGTGTGGGCACCTGCTG
CTTCATATTCGTTAGATCTTGTTCCACTTTCCCGTCTAGTCCTTTAAGCATGCGCCTTAGCTGCTCCATCGTTGTCGGTAAAGCTCGTGGCTGGTACGTT
CTGGAACTCTTTCCAGTTTTGGACGGCTGCGCACCTATCACTCTGAATGTGTGTAGGCGAACGGTGTTCTCCATAGTTGCTTCCTCCACTTTGCAATATT
TGGTCGGATGCTCCGGTGATCTGCATGCTTTGCACGGCCAGTTTACATGAACGTCCTGATGATGCAACCATCTCTGCCTCTTCATGAATGATATAGCCCG
TGTCTTTCAACTTCGGTGGGCACGCTTTCGCACGTATCTTCACAATCCACTGCTTGTCATTTATTCCTGTGTCTCCAATTTCCGTGTGAGCCAAAGTTTG
CACCTGCAAACCCATCTTTTTGCCTAACACCCATAACAGATCCTTGGATGTCATTGCCCCCTTCCTAAGCGAGACTGTGAAATTATAGTAGTCCAATTTC
ACAAGTTCAAAAGTCGTCCTAGCCTCCACTCTTTGGCTTTCATAGTCAACTAGTTGCAGCAACCTCATTGCTAGTGGTAATCTCCACCCGATCCACCTTT
TCGCAGCATTCTTGCCCTTGAAGGTGACTGTGATAACTCTTGTGTCACTGTCGAGCTCAATTCTGGATAGTGCTGCTTTGAATTCATCAATTTCCTGTTG
TTGCTTAGGCGGCGCCTCTGCTCCTACCGTGATCTGTGCTAACAGCGCTCCTCTTGATAAATTTCCCCCAAAACGCTGACCTGGCGCCAATTGCGCATAC
AGCGGATATTCCAGAGCAATGAACATGTCCGTGAAAGTTGCTAGTTCCATTGGCGTCATAGACTGCACAAGAAAACGAGGTGGGAAAGGCACTTCCAGTT
CCTGATTGAGAATCATCAACAGCGCCCGATCTTCATCTTCTGTCCGTTCTCTGAGCTTCGTTATTTCTGCTACTGGTTTCATACACAATTTGAGTAGGCG
CTGTTGCTCCTCCGTGAGGTCCGCTTCTGTCGCCCTGCCTCCTTGTTGCGTTACTGCTCTTAGATAGTCCCCCGTCGATGGCGTTTGTTGTTGTCTCTTT
GCCTCGTGCTTGTTGCTCGTGAACGTGAAACAGTGGATGCGCTCCTCTATCTCCTCTTGGTCCAGCCCTTCCTTCACGACCCACTGCTTCAACAGAAGTT
GCATTCTTCCGGCGTGCTCCTCGTTCCCATTCTCCCAGAAGCTGATTATGCCCTTGTATTTAGCGCGCTGCTGCGACGTGATGTCATCCTGCCATTCTAC
TTCACTCTCCGCTGCTTGTCCTTGGCTCTTGGATGATACCGCTTTCTCGTCTTCGTACTTTTGAAATCTTCGCGTTCTGGCCAATTCATTGAGTCGTTGC
ACCAGATGGAATACATATTCTGCCGGTGCGTCGTTGAGTAGGTAGGACCGCAGCTGCTTGAAAACTACTTCTCCATCTCCCTGATCTGCTCCTCTCCAGT
TGCGTCCATTGTTCTTCCGCTGTTTATCTGCTGAGTAATCGGACTGTCGTTTCCGCTGCGGCGACAGTTTTCTTGCGCTCTGCTTGGTCGGGACAGCTGT
CTTCTTCTCCCTAGCCGCTGAGCTCTTGTCAGCTTTTCCCACCGTAGTCCACTGGATCTCTGTGGCAGCTTTTTGCTTCTGCCGTGTCGACGCCGTTTTA
CCTTCGGCTTGTCCGCCATAATTGTTGTCGACTTGCTTCAGTCCGCTTTTGACACCCATCGCATTATCCCCGATGCCCTGCGCTTCTAATCGCTTGCCTG
AGCCGTCTACCACGATCGACTCCATGCTCCCCCGTTCCTTGGTCATGTCGTCTCCGTGCTTGCGTCCTTCCAGTTTTATCTGAAAGATTGTATACCGGGG
GGTTACGCGTCCTTCCAAACGCCCCCCGTAAGCTGTTCTCCGCCGATCTGATCCCGAGTCCGGAGAGTCTCGTTCGCCAGCCGGCAAGTTGGGAAGTGGT
TTGTTCTTAATCTAGGCGGTCAACTCGTTCGAGTAGAGAACACCTCACCCGCCTAAATCGAGACCAGCACCGACACCTCGTGTCGTCAATGCGAATGTCG
GCCAGTGTCCTTTTAGTCATTGCTGGTTTTCGCGACGTGATCTCGTCATTTGTCCTGCCCCATATGCGGCTGGAATGCCGAGTCGATCACTACTGGTCAC
GTAAAGTCTTGTTCGCTGCACGACGTATCCTTTCGCCTCCATGAAGCTAACAACGATGCCGCTTATCCTTGCTTGGAGGGATCATTCGCAGTTTTCACGC
CTCGTTCACACGTCGCTCCAAGCCACAAGTGCGATGGTTCTTCAGACAGCACTGCTCTTCGCTGGTGCATGCGTTGCGTGCTTGTTTGACTGCACCGCGG
GGTTGACCAAGGGGCACGACCTCTCCTCCGTGGGGCTCATGGAAACTGAGCAAGGCGCCAACTGGATCTCCACCTCGGGTAACACTACCACGATCGAGTC
CATCCTAAGCGGAGGAGGCATGGACACCGTTCGGCTTCGGTATTTATTCACCTGAAAACTACTTCGGTAAGTACCAGCTACTAATCCTGTGAATGGTTCT
GTACAGCATCTGGACGGACGGCGAGTACGATCTGGACTACACGTTGGCGCTGGCCCAGCGATTCTCCAAGGCCGGGTACAAGATCTACTTGGACATGCAC
TTCTCCGACACCTGGGCCGACCCAACCGACCAAGCCATCCCTTCGTCATGGGACGACAGCTCGGTCACAACTCTTGCCGCTGATCTGCAGGCCTACGTGA
CGTCGACACTGAAGTCCTTCACGGACGGCGGAGTCGACCTCGACATCTTGTCGTTGGGCAACGAAATCACCGACGGATTCCTCTTCCCGACCGGTCAAAT
CAACAATGACGACTTCAGTGCCTTTGCTACGCTGTGGAAGGCTGCACGGCAGGGCGTGACAGACGCTGTATCGGCCGGCACGACCCAGCCCAAGGTGATG
ATCCACCTCGATAATGGCTGGAAGTACGAGACCGTGTCGTGGTTCTTCGACGGTCTTTTCGCGGAGGGCACCGTGACTACCGACGACGTGGACGTGTTTG
GCTTCTCATTCTACCCGTACTACAGCACGGACGCTACCATCGACGCCCTCACGTCTTCTCTGACTCAGTTGGCCAATTCGTACAGCAAGCCGATCTACGT
GGCCGAGACGGACTGGCCGACGGAGTGCTCGAGCGTCACACTGAGTGGTGACTACCCAGTGAGCGCCAAGGGCCAACGCGAGTGGGTGATCGCCATCATG
GACGTCCTCGAGAGCTTGCCCAGCAGTTTGGGCGCTGGTATTTTCTACTGGGAACCAGCATATCTGACGGTGGCAGGTCTCGGAAGTTCTTGCGAATCGG
CGCTGCTTTTTAGCGTCAATTGGGACAACTGGCCGGAGACGTACGCGACTGCGCTTTCGTCGATCAACATGTTCTCGTGAGCCTAGGAAAGATTGATGCA
GATGTATGTCGAGAAGGTGTCCATTATCACCTTGTTGCGTACAGTTCAGCGGGAAATGTAAAGTCTCCGTTTGTTTAGTCTCCGAATGCACGTGTCAGTG
TCAAGGATTGCCTTGGCACCAGCTGCACAAGCAGCAAGAGATCACGCTAGGATGGGGGCTCGCTGTTGGGAGAATAATCTCTTCAACATGTTGAAGGATC
TGTCCTTGTAGAAGCACCTATCTCGTTGTTCGTTCCTAAATCAACTTTTTGGTCGCCGGACTGCACTGGACCTGCTCGTCATTCTCCAATTCCTACCCCA
GGCAATCAGTTCGAGTAGACAAGTAGTGGGAACATGGTCGTCGGAAGGACGCTGCTTTGGGTTGGTGTGTGTGCGACAGCTCTGCTCAATGGAGTGCAAG
CGTTGACCAAGGGCCATGATCTATCGTCTGCTGCCGTCATGGAGAAGGAGCAAGGCACTGTTTGGTACACTACCGCGGGCAAGGAGGCAGCAATCGAAGA
GATTCTTGGCGCTGGAGGCATGGACAGCGTGCGACTTCGGTGCGTACTAGTCCAGCTACACTATCTCAATATATTCACCTTACTGAAGGAGCTTGGTACT
AACTAACAAATTGATACTTTACAGACTTTGGACAGGAAAAGAATACGGCTTGGACTACACCCTAGCACAAGCTCAGCGATTCTCCAAAGCGGGATTCAAG
ATTTTCCTAGACTTGCACTTCTCCGACACCTGGGCGCAGCCGAGTGACCAGCAGACGCCGTCGGCTTGGGACGCTTCGTCCGTGGAGACGTTGGCGGCGG
CATGTCGCGACCACGTCAGCTCCACGCTGAAGGCGTTCACCGATGGCGGAGTGGGGCTGGACCTCTTGTCTATCGGCAACGAGATCACCGACGGATTTCT
CTACCCGACTGGTAAGATCAGCAACGACGATTTCGGACCTTTTGCCAAGTTGTGGAAGGCGGCACGGGAAGGCGTTGCGGATGCCGTGACGGCTGGAAGT
ACACAGCCGAAAGTGATGATTCACATCGACAACGGCTGGAAGTACGAGACGGTGTCGTGGTTCTTCAAGGGTCTGTTTGATGAAGGAACGGTGACCACCG
ACGACGTGGACGCATTTGGGTTCTCGTTCTACCCGTACTACAACACGGAGGCGACGCTGGACGCTCTCACATCGTCACTTACTCAAATGGCAAACACGTA
CAAGAAACCGATTTACGTGGCGGAGACGGACTGGCCTACGAACTGCACGAAGGTGACTCTGAGTGAGAAGTACCCAGTTAGTGCACGGGGTCAGCGCGAG
TGGGTGACAGCTATTGTGAATGTGTTGGAAGGTTTGCCGAACGCGCTTGGTGCTGGTATTTTCTACTGGGAGCCGGGCTACATCAAGGTGCCGGGTCTGG
GCAGCTCGTGCGAGTCAAACCTTCTTTTCGATGTGAACTGGGATAATTGGCCGGAGACGTACGCGACGGCACTTACGTCGGTGGACATGTTTAACTGAGG
GTTTGCCTAATCTTCTCTTTGAAGATTATGCACATTTTTGCTTACAGATCTAGTGCTGTTAAAACTTGAGTAAATTTCCTAAATGTTTATGGTTTCATGC
CGGAAACCATAGGGTAAAAAACAAATGGCCTTTTTTTTTTTAATGAACCAAACGCTACTATTATAATCACTATCTCTTGCTTCTGAACATGGAAAATGCA
GTTGTGAGTTTACTTTTGATTATGCTTTTGACAAAGTGATTCCTGTTAGTCAAAAAGCGCGCAGTATCTCGATGGTAAGGCAAATGTATATGTTAATACA
CTCAGTGTTACATGAGCACATTTTAATTGCTATATGAACTCGCTTGTTTTCGGAGATATTTGACATAATCCCGAGCTGTTAGTACAGAGCTCAAAAAAGA
AAACTACAATATAATAACGATAGTGTTAGAAATTATCGCATAAATTCAGTGTATGAATAAACAGAAAGCGGGCGCCATTAGACATTTTTGCTTACCTTTT
ACAACTTGATAGGCTCACAAATATGTCTGGGGTACCTCCTGTTGGACGAACGGGTCAACTAGCGACGTTGCTGTCAGAGCTGAACCGCCTGATCGATGAG
GACCGTCTCTTTAGTTGTAGGAGTTTCCGAGGCTGGCAGCAGGACCCTGCATTCTAACACTCAATTCATCCTACATCTTTCCTCACCACGAGAACTTCTC
CAAGTTCCGACAGATCGCGCCTGTTGAACTGCCCACCACGACTGCAACAACGAGCAACGCCCCCACCCTCAACAAGGACGTTTTGCAAAACGAGGCACAG
TCAAGAAATTAGAGATGTCAACTCCAAATTTTGGCTGTGTCTGAAACCGGCATATAACACGGTTGGATGCGCTGATCGCCAGAGAACAGCTCTGCTGGAG
GAATAAATCCATTCAGTGAGATTCAATCCTATTTGTCGCCGGGTAAGTAGATTGGTGTTACTACGTATAAGTAGATTGACGCTAAACCTACTTACTCAGA
CTTGACGACGCGAATCTGACTCGGAAAACATTAAGAGAGTTGTCATAAGATTTAAAGATGGCATTATCGGCAAACAAGCACTCTAAGGAGATCCTTCATA
AACAAACCAACGATGGCAACATCGCGCGTAAGCTGCCCCCTGTGCTAGCATAACCTCGCCGCAACTAGCATACGGGCTCATATCGGCCAGCTGGCATGCG
TGGAGCGTACTTGCCCAGAGCTGAGAGCTAGACCCCTTGTGCTTGCCCAGCTAGCCAAGAAGGACTATGATCGTCGCTAAGCTCACGCCTGTCGCGACGG
CATTCAGGATATGGGCGTCAGACTGCTCGAGTGGGCAGCGGTCACCTCTGTCGAGGTTGATCAAGGCATCCCAATGCAAGAGACACCAAATGCCCACCAT
GTATTCGATACATTTGTCCCAGCTAGCCCTGTTCCATTTGCATCAAGAGAGGTGGAAATTATTGACATGACAGACGATGACAAGGTCGATGAAAGTACCT
GCTCAATTTGCCAGTACGTATCGGTGGATCCGGTGCCACCGCGTTCGTCCTGTCATGCAATGTGCTCCGAGTGTGTGTTTGCTCTCGTCGTCCATTGTAT
TACAGAGGATGTTAACCCGCACTACCCCATTTGCCGCGTCATTGTGCTTGTAAAGGCATTTGTTTAAACAATGTTGTATTTCAATATATGAAGCGGTTGG
CCGGACCCCGGGTTCCCGCAACAGAAACCGAAAAAGGCGGGAATTATTTATTTAATTTTGGACCTGCGGTCGCGGCGACCGAGTGCAAAACTACATCGTT
TAGGAAACCAATAGCGCATTGGGGCCGTGTCGAGCAGCAAGTCGACCGTGGACCCCGTGTGGAGAAGCAAGACGCCCTTGTTTCAAGAGCATCAAGCGAA
TATGACGCAACGGCGCGGAGGAGGGTTGCGGTCAACAATCCCGCAACGTAAACGGAAGAAGGGTTCTGACCGACAAGCTGCCGCATACCTTCGAGCAGTA
GAGCTCCTGGGTGCTGACACCGTGAAGCAGATAAGACAGGATTGGGAATCTTGGGACACAAACTTCGGTGGCAGGGAGTGGCAACAATCTGAAGGCGTGG
TGCTGCAGTTGATACAACAGGGACTATCCGAGCGCGTGATCCGATCCATTATTCCAGTCGGTGGGAGCCGTATTTCGAGGCTGAGAAAGGTCCTTAAGGA
TGGAATTGACACCTTACACACAAGAAGATTGCCAATCAAGCCATGGCACGCATTTAGTGAGCTGGACCTGGATGCTTTTAAGACTTACTGCGCATCTTGG
ACACTCGAGGATGGTTTTCCCTGCGCCCACCGCCGCCCACGTCAGTACTTCACAGAGCCGAAACTGACGTGGGTTGTCGTGCATTCTCGGTATGTGGATG
ATATCTTGCGCGCCCATCCCGACGCCAGAACGCTAAGCTATTCACGCTTCACTCAGTATGTGCACTTTTACTACCCTGGCGTCCGCTTAACACGAACTGC
AGAAGACGTGTGTGATTGTTGTATTCGAAATTGACCAAGGTGTCTGCACGGCGCGCAAAACGGTAAGTACGCCAGATGACCAATCGATCATATTCTCGAT
GATACCGCACAGCAACATCGAGTCTGTCCGCAAAGCAGTGTTGGCTGAGCTTTTTGGAGCAAACATCAAAAGTGTTTGGGAAGCATCCGTTCGCGGCGTC
CAGCTCCCTCGCCATCCAACCAAAGAACTATCCGCAAAGAAAATCAAGTCATCGTCAGCTAAGTATTTCTCAATACCACAAGAGCACCTCGGCTACTATC
CTGCCGTGCCTGAAGCGATCCTAAACGCCCCAGAGATCAATACCGAGCACACCGAAACAGGAGACCCCAACACTGATGCCACCGCGGGAAAACACAAGCC
TGGTCGACCTCACAAGAAGAAAGTGAAGCTGCGAGCTAAACAGCCTTCCATTCTGCAGTTCTTCAGCTCTGCTGCGAAGTAGAAAGATAAAGTAGTTTGA
CCTTTTTTTAAAAGAAAAAAATACCATTGCATTTTACCAAATACCGGTTGTTTTGCCAGAACCGGGGTCCTTGTGGGACCCCGGGTGCCCGCCAAACGCT
TCATATATACTATAAACTGACGGGATAGAAACCATATCATTGAATACAGAAACAGCAAATCACGTCATCAGCTTTTCAAACTTATTGTACTCGTACGACT
GACCTTGTACAATTTTACACTGAAATCGATGTGTAATCGTGGCCTAAACTTGTATGATTTTACACAAAATCCGAAAGATATAATTATCATAAACATACAA
TTGCACTTGCATCATTTAATAATATAACCTAGAGGGTTGGTTAGAAAAAATGTATAATGTATAAACGTACCGAATTTCCCAACCAGTTGGCTGTCTCAGA
CAAATTGAATGCCACTTCGTCGTATAATGGTTGATTGTACATTTCGTCAAACGCGTACGTAACGCAGTGTGCTTTATCGATTCCGTTCAAGTACTCAGTA
GCTAGTGGACGTGTGTCAGATAGTTTAGAGTTGTAGAACTTGTAGTTTTCACATTCACTCCGCACCATCTGAAACACGAACGCCTGCTCCGGAGGCGACA
AGGTTGACCCCTTCTTCTCAGCGATCGCTATGATGTTTTGGTCACAGAATCGATGGCTAGATTCCAGGTACAGCTGACTCACAGATGAGATAAATCCGTT
TTGGTGATCAGAAACAAAGATGAGTTTCCATCCATGACCAGCGGCCTCCACCGCATATTTCATGTGCGACAGGAACCAACTCCAATTCATATAGTCTTCT
TGCTCCACCAGAGCAAGACCAAATACAAGAATATGGCTGGCGAGGGGGTTTTGTAGTCACGAGAAGAAACACACCACACTTGTTCATGTCACCCTTTAAA
TAGGTCAAGGATATGTTTGTAATATTGCATCGCCTGCAAACAAGCACCAGGAAAGAAACAGGCTATTGAAACCGCCATGGTCGTGCTTCTCCAAACCAAA
ACTCGATTTGGCGTTAGCCTCCGTAACCATGAGCAGATACGCTTCCAATATCTGGTAGCTCTCAGTGATATCCTCGCGTAAAGATCCAAGAAGATCTCGT
TTCAACTTCGACACCATCGGGCGGTTTGTAGTGATTCGTTGGATTTTTAGAAAATCCAAAATGGCGTCACCTGCGACTGAAGCCCAGGTATTGCTGTAAG
CAGGAAGTATTTCTCGCTTTAGGATGCCGCGTCGTCCCGTATGGCACATGGCGCTGACATTGCTGTTGCGTATCAGCCACAAGGTCGTCTTCAACAAACG
TGTCTTTTTGAAAACCAGCATGCATGCGCCAGATTCATCTACGTGACCTACCACTGATTGCGTAACCCATACACACCGCGATTAAGATTGGACATTGCTC
GACACTCCCTAGAATCAGCGGCTGTTACCCTCCAGGCGCTTGCACGCGTAGTTCGCGTTTCCTTCCCGGGTGGCCTTTAACCAGCTATTGTTCGTCACAC
GAAGGGAAAAGCCCTGTCGACGAGCATACTCCCGACAACGAAGTTGTACATCCTTTCTTGATCAAATTAGCACTTTTACCAAAGCAAGTGAACAGTGTGA
CAAATGTGTTAATAATGAGAACGAAGTTTTTCGTTAAAATGCTTTTCCCACAAAGTGAAATTTCATGCATTCGTGATTCTAACCAAGTGAACATCTAGCA
CCAACCATTGTATTTGAGCCGCAAGGCACAACCGCTCTCAGTTCCAATCCGCCATACCTTCCTCCGACAAACTACCAGCAAACGCCAACATGAACGTGCG
TGGAACTAAGGCCCGCATAGTGTGTGCGCACAAGGACGGCGAGAATTGGCGCGCCGTCGCCGCTCACAATGGCATCCCCTATATCACGGCTCGGTGTGCG
GTTCTCGGCGAAGACGCCGATCCCAAAAGATACACGGCGGCGTGCGAACAGCGCGTGTCAAAATGTCCGTCGAGGTCATGAGCAAACTGGAGGAGTATCT
CGACGAAGACAGCCGGCACACCTGCGAGCAGATGGGTGACAAGTCGTGTAGCGACATGGACGTGTCCGTGAGCATATTCTCCGCTCACCATGCTCTTCGG
GATATGGTCTACAGCCTTAAAAGCTGCGCATTTATTAAGAAGATTTCAATGAACAAGACGGAGAATAAGATCAAGATGATGGCTTTTGTGGAGAAGTTGA
AGAAGTACAGACCTCATCACTGCGGTATTGGCGACAGAGGAGTACTGTATACAGGCACCGATGAACAAGATTGTCGTCGTGACCAACAATGCGTCACATC
ACGGTGAGGTGAAGACGTTGGCGAGGGAGATGCTTGTGATGGACGGCATCATGAACAGCAACAAGCTGGTCGTGCTACGCCTCGCCCCGTACAGCCCCAT
GCTTATCCCAATTGAGGGCAGCTGCAACGTGTTCAAGGCGAAGATGCACCGCTACATTGCTGAACAGAAAGAAGGGTTTCTAGTGAGGGGTGAGTACAGC
ACGTTTTCCGCGCATTGTTAGGCTCTCATAAAGGAGGCTGCTGAAGTAGCCAAGTTTATAATTACTCGTCGTCTGGTTTGTCTCATGGAGCGCCATTGTC
TTAAGGCGTCGTTTGCCGCCGGCAGAGGCGAGGACATGGAGCTGGGCAAGTAGCTGGGTGTACCCCTATTCACTTGGGTGAGAGCTCGACTACAGTAGCT
CGATTTTCAAGTTGTTAAAAATAGCTTTTTCTATTCTAATTATTTTGTGCAAAAAATTGGATGCTCACTTGCTTTGGTAAAAGTGCCAACTCAGTTATCA
AATGGTGTGGTGCTGACCGTGTCTCAAACATTATGTCCGCCAAGTTCCTTCCGTGGTCTGTGACTTGGCCATATATGAAAGAGTGTGTACGATTCATCTG
GAAATCGACATCACTGTGAAGGAGACCCATTCCTCGGAGATCTTCGATGCTCGCAGTCTCGACGTGGCTAGTAGAAGTAACTAGAATCGTTATATTGTCT
CACGCTGGTACGAAGGTTGGACATGGTAGGTGGAGGGACAGCGGAGAGTTCTGTCGAATAGCAGAATGAGGCAAGGAATGTGACAGCAACGTGTGTGGTG
GGCTCACGGTTGCGCAACAAGTGGATTCTTCTAGGTAGTGTTTTCGTAGCAGCAGCAAAAAACACAGGAGTCTTGACACCTCTGCCAAAGAGTCGTTTAA
TGCGATGCTTTAGTAGGGCATAATATATGTAGGTACCAATTGAAAACGGACAAACTTTAAAAGTGTACGAGTCGAACGATCTCGCAAATTTTAATTTATT
TTATGAGTCGCACGATTCTACAAAAGATAATTTTAATCGAGTCGTAAAAAGTCGTAAATTTGAATTAATAATTAGGAAAATTAAGGATAAATAAGGTTTG
GCTTCAATCTACTGATAAGCAGTATTAATAACACCAATCTACTTACCCGGCGACAAGTAGGGCTGAATCTCATTGAATAGATTAGTTCCTCGCTCTGCTG
TGACGTCAACACAGAGATCAAAGGCACCCTAGCTCGAGAGTTACTATCCGATGCCATAGATCTCGGGAAGCTCCTCGATCTCCAGAGTTAACTTGCCTTG
CTTTTAATTAACGCAATCAGCCGTGTTGGCAGCCGGCTGTTCACTTCGCGGTTTCGGTTGGTAATGGCAGTCTCCATTGGCAGCCTTGTGGTGCTACCAC
TGGTGGTGATGGCCACAAGGGCTAATTCCGTCATGTCCTCTGGGTAAAATCTTTCCTCGGCATGAGAAAATAGACGAATGTGAGGCCTTCATGTTTCCTT
CAAATGACATTGGCGCTTGACCATGGTATTTGGCGCCCAGATTTAGGGCCGCTTTTTTGCAATTCAGAGACCCCGTAATCTTGATTTCAGTATGGTCTGC
CCTATTCACTGAGTACGGTTCACCAGATTTTGAGATGGTGAAAAGTGTCAAGTCTCCTCTGCAGCCTGGAGGACATGTGTGCGCGCACCGAAGGTGAAAT
GGTTCTACGCTACGTGTAAGCTTATCCAGTTTAGGTTGGGTGCAATCAATTAGATCACATCTGCAGGGGAAACAGGAGCCTAGTGGCGAGTGATATAATA
CTTTCGCCGTGCTTATTTGGCACTTCGCTGCTCGTTTTCTTAATCTCCGCCCTCTGGTCGACGACTAGTGGTCGTACATTCGCCTCTGGTGCACCGGATC
TGCTCGCTTATGTCACGCTTCTCCATCCTTGACAACCACTTCGATTTGTCAAGTGAACGGAGGAGGGAACTATGCTCGCTCGGAGAACGCTGCTGTGGTT
GGGAGCTTTTGCGGCACCTCTGCTCAATGGAGTGCAAGCGTTGACCAAGGGTCATGATCTATCGTCTGCTGCCGTCATGGAGAAGGAGCAAGGCACTGTT
TGGTACTCCACAAAGGGCAAGGAGATGGCAATCGAAGAGATTCTTGGCGCTGGAGGCATGGACAGCGTGCGACTTCGGTGCGTACTAGTCCAGCTACACT
ATCTCAATATATTCACCTTACTGAAGGAGCTTGGTACTAACTAACAAATTGATACTTTACAGACTTTGGACAGGAAAAGAGTACGGCTTGGACTACACCC
TAGCACAAGCTCAGCGATTCTCCAAAGCGGGATTCAAGATTTTCCTAGACTTGCACTTCTCCGACACCTGGGCGCAGCCGAGTGACCAGCAGACGCCGTC
GGCTTGGGACGCTTCGTCCGTGGAGACGTTGGCGGCGGCATGTCGCGACCACGTCAGCTCCACGCTGAAGGCGTTCACCGATGGCGGAGTGGAGCTGGAC
CTCTTGTCTATCGGCAACGAGATCACCGACGGATTTCTCTACCCGACTGGTAAGATCAGCAACGACGATTTCGGACCTTTTGCCAAGCTGTGGAAGGCGG
CACGGGAAGGCGTTGCGGATGCCGTGACGGCTGGAAGTACACAGCCGAAAGTGATGATTCACATCGACAACGGCTGGAAGTACGAGACAGTGTCGTGGTT
CTTCAAAGGTCTGTTTGATGAAGGAACGGTGACCACCGACGACGTGGACGCATTTGGGTTCTCGTTCTACCCGTACTACAACACGGAGGCGACGCTGGAC
GCTCTCACATCGTCACTTACTCAAATGGCAAACACGTACAAGAAACCGATTTACGTGGCGGAGACGGACTGGCCTACGAACTGCACGAAGGTGACTCTGA
GTGAGAAGTACCCAGTTAGTGCACGGGGTCAGCGCGAGTGGGTGATGGCTATCATAGACGTTCTCGAAGGTTTGCCGAACGCACTTGGTGCTGGTATTTT
CTACTGGGAGCCGGGCTACATCAAGGTGCCGGGTCTGGGCAGCTCGTGCGAGTCAAACCTTCTTTTCCACGTGAACTGGGACAATTGGCCGGAGACGTAC
GCGAATGCACTTTCATCCGTTTACATGTTTGGCGACAAGGGCTCTTCCCAAGGCAACAGCTCTGCTCAACAGACCAGCCCCACTCAAGAAACCCAGACCG
ATCCTTCGCAGCAAATGCAATCCAGCTCCTCGCAGCAGATGCGATCCAGCTCTTCAGAACAGGAAAACGAAGATACTGAGCAGCAAACGGCAGCTTCGGA
AAGTACCACGTAGCAACAGTAGCCATCAGAAAATATCCTGAAAATATCAACAGCTCCCATCGAGCAAAGCTTTGATTGAAAACTTGAACCACGAGACAGA
GCGAAATACAGTGAAGCAAGCCCGCTTTCAAATACATGTAGTAAACAATGGAGGTGCCGCCCAGCTTTCATCCTCGTGCAACCACAGCCTTCGGGCACTC
CGGGGCTCGTCTGCAGTGCGTTCGGCTTTGGCACGGCGTAGAGCGTGGAAGAGTGCTACTGAAAGCGCTGACGAAACCAATGCGTGAACACTTGCAGTGA
CGAGTGCAAGGACCACATAGCTGCTTGATCTATGTTGTCGATATTTCCGAGCTCAGGAATTCACGTAGGAGGTCGATCCGAGACTTCTGTTAACGTGGGG
TGCTACCTGGGAAGCACACACCCAAGGGGGCATATGTCAGGTTAGTGACGCGTAACACCGCACTAGATCTACTACAGCAAGAACCCTTGAGATGGGATAC
ATGTACTCCACCAGTGAACTTCAACCGGAAGACCTCAGCCGAGACTTCAACGGAGCAGCAATCTGGTTAAAGACGACACTGCCTGCAGGCTTGATGCACT
GTTCGAATGAGTCAGCTACTACAGTCATACTTCAAGGATCAGACTGAGCAACTACACTACGAGCTTACGTGGTATTTTTGCAGCTGAATGTAGGGATCCC
TGCTGCTGCCTCCCTCCTCACAAACACCAGTGCACTAGTCGTGCACTCCATTCCAAGAGCTTTTCGAGAAGCTCATTCCCGATTTTCAAGTCTGCTCCGC
AAGTCCAACAGCAAAACAACCAAGGAGCCGAATGTTTTTCAAGTCGGCACTTCTCGTTGCCGGTGCATGCGTTGCGAGCGTGTTCACCACCGCTGCAGCG
CTGACCAAGGGCCACGACTTGTCTTCCGTTGCTTTGATGGAAACAACCCAAGGTGCCCAGTGGATCTCCACCTCTGGCAAGACAACCACGATCGAATCCA
TCCTCGGGGATGCAGGCATGGACTCTGTTCGACTCCGGTACGTCCACTTGTCAGCATTAACCTACACCACTCACCTCTCTGACGGTATAACGCAGCATTT
GGACGGACGGTGACTATGACCTGGACTACACGCTGGCGTTGGCCAAGCGCTTCTCCAAGGCAGGATACAAGATCTACCTGGACATGCACTTCTCCGACAC
GTGGGCAGATCCGCACAAGCAAGGCATCCCTGCAGCATGGGACAAAACGTCGGTCACGACGCTGGCTGCTGCTCTGCGATCCTACATGAAGTCGACGTTG
AAGTCCTTCACGGACGGCGGTGTCACCATCGACATCCTGTCGCTGGGCAATGAGATCACAGTCGGATTCCTCTGGCCGACGGGCAAGATCACCAACAGCA
ATTACGGTAACTTTGCTACGTTGTGGAAGGCTGCGCGTCAAGGAGTGACGGATGCTGTAGCGGCCGGTACCAAGAAACCCAAGGTCATGATCCACATTGA
CAACGGATGGGACTACAGACAACGACACAAATACCCGGGCAACACAAAACCCGGGAACACGAGAAAAATACATTTATTTTTACCAATCAAATTACTAGAA
AAATATATATATTTACCAATCATGAAAAAATAAAAATTGGATGGCCAGCAGCTAAAACGCCGAGGCACCGGCCAGTCCTGCCACTGCAACAAATGCCGCG
GAAGCAACATAGCTACACCATGAAGGTGAAGCTGGTGGCGCTGGATTCCATCGAGCGGATCGGCTTGACCGCGACGGTCGCCGAGCTCCGGTACCCCCAT
GGGACCGTGGACGGGTGGTGGCGGGCGCGTGACAAGCTCCGAGCGTACGCTGGAAACAAGCTGTCCAAGACGATAAATGGGCAGGGGCGCAAGGAAAGCT
TTCTTTCACCCCAGCCCTCGTCACCTTCATGAAGGACACTCGCCGGGACGAAGAGGTACGTTTTATCATATTTTACAATTTTTGCATTATTTCTAACGTT
AAGCGTCTATGTAGTGGCTCACTACGTCGATAATGATAGGTTTTATAGCGGAGAACTATGAAGAATGGCTAGAACAATACGAAGAAGGCAAAACGTCGCC
TCAGAGCTGCCGAAAGGCGCTGGAGAGACTACTGCAGAGAACAGAAAATCGGTAAAAACTTTTGTCTCAGTACATTGAACATTATATCTATACTAAATGT
GTCATGTACTGTCATTATGTACTGTTTTTAGATATGGATTTTCGACACAAAAGGCTCAAGAAACGAAGTTGCCGTGCTTAGATCTGATGCAGATTAAGCA
GGACTTTGCTATTGAGTTTTGGTCTGTCTACAGCTCCTACTAACCTTCTGAAATTCACAATATGAGTTTTCAGAGGAGCTAGTAATTTGTAGCTTTCAGA
CAGCAATTCCTAGGATCGAGTCAATGACAGTTTAAGCGATTAATAAAATGGTGTTTTTTATATTTTCTTTGAAGTTTGTATTTACCAATCAGAGCATTGG
TCTGTGGCCTGTTTGGCCCGGGTATTTGTGTCGCTGTCTGTACGCCTACGTGTCCGCGTTCTTCACCGGGCTCTTCGCTACTGGTACGGTGACTACCAGC
GACGTGGACGTGTTCGGCTTCTCGTTCTACCCGTTCTACGACTCGAAAGCTACGATCAGTTCACTCAAGTCTTCGCTGACTCAAATCGCCAACAAATACC
AAAAGCCGATCTACGTCGCCGAGACGGACTGGCCGACGGAGTGCTCCACTGTCACGCTGAGCGCTAGTTACCCAGTGAACGCCAAGGGCCAACGCCAGTG
GGTAGCTGCTATCATCGACGTCCTGAACGGTTTGCCAAGCAGCTTGGGCGCCGGTATTTTCTACTGGGAGCCGGCGTACCTGACGGTGGCGGGTCTAGGC
AGCTCTTGCCAATCGGCTCTACTCTTCAGCGTCAACTGGAATAACTGGCCGGTGACCTACGCGACGGCGCTCTCGTCTGTCTACATGTTCAGTTGACCAA
CCGGTTGACGGAGACCATAGCGTCTAGCCTGTTCTTTTGCAAAGTCGAAGAGTTTAGTTCTCTTCGAAGCCCAACTAAGCTTGATGCCTGCTCGTGGCGT
GTCGAACCACACTGTCTCCTTAGTGTTCCCTTTGAAACTGGGCAAATCGATCTCGAATTTGCCTTTGCTGCTGATCGAGTAGGTTGGCGACGAATGTGGC
GTCTCCACTTTGCCCCGGTTCACCCAGCCGCTCGAAGAAGATTGCACGCACCAGGTCGGTACTGAGACGGAGATCGCGCTCGATGTCAGCGCGCAGGCAA
CCGACCGTTTTCTTGAATTGCTTCTTTTGAAGTTGCTCCATGGGTCCGTACAAAGTGCTGCAGTCTTGAAGATCTTCGTAACTTCGCTTTGTACCAGTCT
GAACTCGACCTGAAACGCGGCCATGAGGCGCCTCCGTACGCAGTTTTGGCCTCGGTGTGACCTCTGTCGAGACTTCTTCGGTACTCTCTTCACTCTCATC
GGAGCTAGAGCAATCACCGAACAACGTCTGGTCAATCCTTTTCTTGGGTTTTCCATCTTCCATGTCGGCTGGAACGCTGAAGATTTCGCCATTTTCTGGA
GCTGGGGCTGGCAAAGTGCATCCAGAGGAATCTACGCGCTGCATTTCGTCGAAAATGTCGTGGCTGATGTCTTCAAATTCTGCTGGGAGAGCGTACCAGT
CTACACGCAAGCTTTGCTCGCTGTCTGAGAGCTGGAACCACGTTACGGGGGCGTGGCGCTCGTTGAAAGCTCGGATGAAGAGATACGAGGCGGCAATGCG
CTTCATTTTTCGCCAAGCGCTGAAGGTCGAGTGACTCCAGGGAGTGTATAGCGTCGCGGACTCGTCGTAGCCCTGAGCCATGAAAGCGCTGACCAAAGTG
TTTGACTTCTTCATCACATGACTCCAAGACTGTACGAGAGATTTTACTTCGCACGGAGACCAACACGAACTGCACTTTGACGGGTGCTGAGCTTCTGTTT
TGGGCTTGGATGCAATCGCTTTCCGCACTTTTGCCCACTTGCGCACCGATTTCAGCTGGAGAAGCGTCTTGTAGGACGCCCGTGTAAGGTTCCAGCAGGT
TTTCCTGACTGACGTAGGCATCTCCACTCGGTTCCGTTCTTCTCTAGGCAGATCAAACCACAGGCGACCACCGGCCACTTGCTGAATCTCGTTGAAGCGG
TTTACAACTTGTACGACCTTGTAGAGCTTGCAGCGCTGGCATCCGATACTGTCAGAAGTGCGACTTTTGTTGGTCCGCTGCGAGAGTTGTTCGGCAATGT
GGCTGTTAATGCCGCCTCCACTCTTCGTCCGCGAATGCATATACGCTGTAGGGTTAGATTCCAGCTCTCTCCACAGCTCAATCATTAGTGACACCTCTTT
CTCGGTCCATTCCGGGTGGAGGAAGCTCGGGTCGCTTCGATCAAAGACCCCCGCGGACTTCATCCTACTTGAGCAAGTGGTTTCCCCGCTTGAAAAAATA
AAAACGAGAAAGGGAACGGCGTTGAACAACAACGTACGAGGTTCAATTCGAAAAGTATATTCCTAATGGAACGAAGATTGACTACACCTAGCACAGGTCC
CCCCTCTGCTGGTCCTCCGATCGGATCATTTTTTCTCGTGGTAACGCGGTCCAAGAAGCGCGCGGTTCTCAGCTTCTTCACGGGTCCGTTTCTCCATAAA
CTGATCAAACCGATCGCGGATCTGCTGCTGCTGCATGTTCAGTACCTTGGTCACGAAAGCGACGTCGCCGCTGCTCTCCGGGTCCTCAAACTGGTGGCTG
ATGATGGAGCGCAGCATCTCCGCGCTGCGTTGGATTTCGCTTTCAACGTCAGCACGCAACTTGCTCGCGGCTCGACGCATTTTCTTGTTCTGCAGCTCCA
TCATGTTGTCGAGAAGAATATTGCAGTCGCGGTGCTTGCGTTTGGGCGGAAAGTCCAGCTC