Description :
From Genome Similarity Track
Location :
contig_196:5592- 6794
Transcript NameFunction/comments
g12277.t1hypothetical protein

Sequence
1202 bases(100 bases per row)
TGTCGACATGGTGTTTAGACACCATGGTATGCCACTCGACATCGTGTCGGATCGGGATCCGCGCTTTACAGCGCGATTCTGGCAAGAAGTGTTTACACTT
CTTGGGACGCAGTTGTCCATGTCGACTGCGGATCACCCGCAGACCGACGGACAAACAGAGCGTGTCAACCGCGTGCTGGTTGACACCATGAAGAGCTACG
CGCACTCGTTCCATCAATGGAGCGACTGCTTGCCGATGGCGGAGTTCGCCATCAACAACTCGGTGCATGTCTCGACAGGACACACACCGTTCTACGTGAA
TGCCATGAGGCACCCACGCGTACCGAGCGTACTCGGTGCGGTAGCTCCTTCCTTAAGTGGGGGAGGATATCCGGTTAATTCAAAACAACCGGATAAGCAC
GCTGATACAAGCAATGTATCAGCTGTGACGACTCGCGCACGTACTGCGCGCAGTCATGGCGACGACAAGACAGTGTCTACGACGGGCGTAGACACTTTAA
ACGACAACGAACATCACGCGCAGGCCGGGCCTGCTGCGAACAAGGAGCACGAACTGAACCAGGGGTTCAGCTCGGATGCAATGGACTTTGTCCAGCGTCG
ACAAGCCGTAATTCGGTTTGTCCAAGATGCAATAGCAGCTTCTGTCGATCGACAGAAGCTGAATGCCGATAACACGGCAGGGGAAACACAAATGAATTCA
AAGTTGGTTCATTAGTTCTGTTAGCTACGCAGAACCTAGCTAAACATGCAGTTTCCGATTTCGGAGCAAGCAAGCTTGCTCCGCGCTTCATTGGGCCATT
CACCGTGTTGGCGAAGCATGGCAACGCGTACACACTGGACATACCGTCCAGCATGCGCTTGCACCCAACGTTTTACGTTGGGCGACTGAAGCCGTACGTG
CAGCACGAGTCACCTACGTCTGGTGACTCGCCAAAGCGCTCTCGAGCGCGGCGACGCGCTTCGAGACGCCAGAGAGCTCGTCCCGACCTCGACCTTTACG
TTCGAGGTCGTCTGCGCAACCTCCGCGAGCTGAGCCTTTAACAAGCTCAGCTCCTGACGCAGAGCAGCGAACTGCGACGCTTGGAGACGCTCAACAGCCT
CCAAGCGAGACTCAAGGTTTGGTTGACCAAACCCGGGGCGTCTTCCCGCCCCCCCACCCCCGTTGCGAGACGCACGCGGGGCAACTCGCTGGATCGTCCA
GC