Description :
From Genome Similarity Track
Location :
scaffold_21:55919- 64111
Transcript NameFunction/comments
g1148.t1hypothetical protein

Sequence
8192 bases(100 bases per row)
CGCTCCAGCGCCAACAATACCCACAGATTAAGCATGGGGGATGTGCAAGAAAAATTAAACACAGGACGATACCGTCGCATCAGAGCACAACAATACGCAC
CTTACTCGAGTAGACAACCTCTGTGTTGGGTGTAAAGCTTGTCGATTTTCGTGATCACTCGATCCAATGTTTGCCATGTTGTTTGAGAAGGAAGGAAACA
ATTTGATTAGCTGAGTTAACAACTCTTTGGACTACAGTGTAGAGTTAGATCGATAGCTTTCTACGCTGACACTTAAACAATCCAAATTAGTGAGGTTCGT
TCTGGATGTGAGTCTGTTGGTGGGTCAAATCCAAGTTCATGGATGTACGTAGGTAGTTCAGGTGATTAACTTGTTTTTCCTGGTTATTCTATTGGCCAAG
TTCATGGAGGTACGGTTGTTTGAGAAAAAGCTGGGCTCCCCTATAATAAAGATGTAGGGCCTACTGGACCAGCAGACGTACGCAACATGAGATGAGCATC
CTGGTACTGCACAGCGTCCTGAATATTATTGTTACAGTAGAGAAAAATGCCAGCAACAGTAAATTTTGCAAATATTAATAAAATTTATTCCTCTATCATA
ATTTCACTAAACTCTCACTACACGCCACCATTACAATAATTCCATTCAGCTCACATTCAGCTTCGCATTGAGCTTTAGGCGACCACCTTTTGTGGAATGC
GGCACCCAGAGCAACAACGAGCCTCCACCCGTACCAGGAAGTCCCAAGAAGCCAGGACGCCACCGATCCAGGTACAGCGTTTTGCCTCCCAAAGTCGTCA
CGTTCGATTTCCACGTGACGGTCTTGCCAGCCGCGATGGCCACTTCATCGATCTTGTTACCGCCAGATTTGATATTCACAGTGACATCCTCTGTGTCGAC
ACTTGTAAAGGTAACGGTGACGGTGCCGTCACCGACCTTCGTCCAATTGCCAGCGCTGTTGTTGAAAGCCCTTTTCACCGTCTTCAACCCCAACGCTTCT
TTCGCAGTACCGTCGTCGATTTCACCCACAAACTCCGTTGGACCGCAAATGGTCTGGAAGAACTCGGAGATGGCGCCACCGAGGTTCGTTCTGTCCCAAA
CAGCGTAAAACGTTGCTGCCTTGTCGGCGATCTTGTACGCGTACTGACCGGCAGTCAGAAGCGATCCATTGCTGCTCGTTCCGGAGCTGATCAAGTCGTC
CATAATGCCTCTCATACCTTTACGCAAGGTTTCTCGAGTGGTGTACGCCGTCGCCTCGCTGGATTCAGCAATCAGCTCCTCCATACAGTTGTTGGTCACC
GTTGGAATTTCATACAGTGCGAGGTTCGACTTGCTCATTGCAACACGAATGTCGTCCTCAGAGATGCTAGGATTCTGTCGACGGAGTTCCGCTACGGTCA
TCCACGTTCGGTCCAACAGTCGCTTCATATCATAGCCGCAAGTCGAGTTCGATTTAAGAGCAGTCTCCAAATCCGTAATTTCCGACGACTTCAACGAGCT
AATCGAGTCTCCAAGGGTGATATTCTTCATGAAACTCGTGAAAGCGCTCCAACTGGACACAATAGCAGCTCCGTTGGCGAGAATATCTTTCAGCGCAAGC
TCAATAGTATTGGTGAGTCTGTCCGCGAACTTGAATTGCTCGTCCACTTTGATTCCGAGACACGACATGATAGTCACCGGGATGTCGAAGACCACGTTGT
CGGTCTGGTACAGCATCGTTAGCAGTTTGTCTTGGGAAGTTTGTGGGTCGGACACTTCGACGGTTCTCACGTACTTGGACAAGGCCTTGACCAATCCCAT
CATCTCCTTACTACACTTGAACGCGATCTGAAGCCCCTTTGCCATGAGCTTGAACTGGCCGTACAAGTTGTACGTAGCTAGAGAAAAAGCTGCCTGCGCC
ACGGAGGAAACTTTACTGACGACTTCAAGCACACAGTCGTCGTTTTGTCGGATGCACTCGACTCCACACTCCACCGGATACGAGAATGGGCACTGAGCCC
AGCATGTTCCAAGCTTGCCGTCGAATCCCAACGGACACGTCTTGGCAATGTGAGCCTCACGGTAACACGCAGTGTCCTTCGCAGTTCCGAGAGCAGAGCC
TACCCAGTTCTTGTACGTGGACTCGATAGTACTGGTAGCATTGAGCGGGTTACCAATTGTAAACCCCTTGGTACTCGAGTCGTCGCTGTCGGACGAATCG
CTGTCCGACTTATCATCTTGGCTATCGACAGACTCATCGTCACTGTCGTCCTCGATGGCCGACCTGAAGGAGATCGTGGCATCGGAGACTGTCGCGGTTT
CATTTACAGTGAACTTCGCAGTAGCCACAGTTGCAACTGGTACTGACGAAGCGCTTCTGTTGAATGTGTAGGACTGTGCCGAAGCTGAAGCAAAGAAGAC
AACAAGTATATAGAAAAATACCAGTAGTAACCTGGTCATCTTGCGAGCGACGCAAAAATTAGAATGCCATTCCGATTTAACCAAACCGCCAAAACTACAA
GCTGGACGCCGCGTCTATCTTGGCATGTGGTGACCGTCTCAAAACCGACAGATTCATGTCGGTGGTGTAACGCAAACTTCAGCCTTGTATCGAATCTACT
GGCGGCGCGACGACGAATCTTGTAAGGCAACAGATCACCACAGAGTGCGCTCTTCGAGTCGTTTGGTGGTCTAAACAGCATGGCCAATACAATTTAGTGT
GAAACTCGGGAAGCATGACTTGAGCTGACTCCCGGATTCAGTTGGCTAGCGCTAAAGCTCGACGAGAATCTACAGCCACCACATCCCATGACGTGGAGAG
ATACCAATAGGATTGGGTAGATCATAGATGAGACCGCGGTTATGGATCCGATCCAGGATCGGGGCGAACGGGTGTAGCGAGATGTCGAGGAGATTTGCAA
AACTGCAGATTCAAGGTCGAAGTTACTGTACGCCAGGTAGCAGCTTCAATCTCAGTGCTGGAGGCTGCTTCGCGCAGTTGCGGTATCACGTACCTTGGTG
AGGCGGGTAAAAAGCTCCGACAGACCGTCTCAAACTCAGCAATCGACCTCTACAAATTTGCGCTAAGACTGGACAAACAGCGAATCTTCTAGTGAATGAT
CTACCGTTTCGTTAGCGGTCGGCGATTCAGGACCGCCGGTCGCTCCTGAATCCTGAACTGCTGGCCTGAGAGCAAGTTCTGGACCTCCGCACAACACGAT
GTGATCCTTGTACCTCGGCACGTTGCCTGAACACCATTGCTTTCTACCTCGTAGAATCTACCAGACGTGCAAAATTCCCCCGCAACGCGACACTGTCAAG
GCAGACGGCCAGCTTTCATGGTAGCGCGTTGCTTGCTCAAACACGTCCAAACGCAAGCATGTGTGTCGTAGACCGATTGAGAAGTTTATCCAAACGTTTG
TTTGGACGCAGTCCGGTTCCTCAGCTTTCGTAAAAACTCTTGTCTCGATTCCTGGTCGTTGTAGTGAATCGATCCCCCTTCTTCGTCTTGATGGCCTCCG
TACGCAGTGGTTGCTGGTGACACCTTGATGTCCATGGTTCCACTTTCATCGTCGGCGTCATTTTGCTGTTCGTACGAAAGCGCATCCATTTCGTGAGCCA
ACAGGAACTCCCGAATCTTAGCGATCTGTCGTCGCTCCTGTGGAAATCCTGTGTTCATGTGCTCTGCTCGTTTAAATGCGCGCTGAAACTTCTTCGATGC
GTGTGGCAATGGCAGTAGACAGGATATCTCACCTGTCAAAGCAGCACTTGCCACCGGATCGACCACCGTGATCACCGGTACCAACGCAGTCTTGTGTGGG
AAGTAATTGCAGTGATCTGGAACATCAACTTGCATTGTTGAGACAGCAATATCACACCCAGGGCGACGCAAATCCAGTTCCCGCGCTAGATATCCAGAGA
TCCTCGCTCCAGCCGCACAGTGCTTCAGCGCGACGTCCAAAAAATCATGCCACCGCGACCTACCAACAATCAACAATAACCCCCTCAGTACGTCATATCC
CCCTTTGGCAAGTATAACTAGTTGATCGACTCACCGTTGCTCACCGCCTGCTCCATCTCCTGGAGGAGGGGCGCCAATTTCCAGCTCTGGAAGCGGATAG
TCGTCGAAAAAGACGCAGTCGAACTTGCCCAACGACGGTAGCTGCTGCTGCCACGTCCCAGCCACAATTTGCACGCCACTATGACATGCTGCAAACTGCT
GGGCGCGTTGCAGCGTCTCCTGATCACACTCGATTATTGTGTGGCGCTTTGGGTGGAATGTCTGGATGTGAGACGCCGAATAGGCCAAACCGAAGCCGAT
TTCAAGTACGCGATCGGTTGGCGAGATGGTAAGAGCGTCCACACAAGTCTCCATGTATTGCTTCTCCCACTGCATCATGACCTGCTGCCCACGAGAGCTC
CAGAGCGCCTCCTGCCCGAGCTCATCCAGCCCCTTCCTGCTGCCTCGCGTCATCATTAGTATCAATTTTTGTGTGTGACCTATTTAGCTAACACAATATA
TTGAGGAGAACAATACATTTCCATTTTTAAATTTAATTATCAAAATGTTTTAAATTCATTTTATTATTAAAATATATTTGCGTTTGATAATTTAATTTTG
ATAAATAATTTACACTTTATTTTCTTCACTACGAAGTATTCCTGCTCAACTTTCATTGAGCACTACATTAAGGTCGAGACTTCCTTTTGTAGACTGAGGA
ACCCACAGCAACAGCGAGCCTCCTCCAGTTCCAGGGAGGCCCAGAAAACCTGGTCGCCACCGATCCAGATACAACGTCTTCCCCGCTAGATCCGTCACAT
TTGCCTTCCAAGTTCTGGTTTTGCCCGCTCGAACTAGCACCTCGGCGATTTTATCCCCACCGGACTTGATATTGACGCTCACATCCTTCGTATCGGCGCT
CTTGAAGTTGATAGTGACAATACCATCGCCATTTTTGGTCCACATGCCTGTACTGTGGTTGAAAGCATCCTGTACAATGGACATCCCCAAGGACTTGTCG
ACGGAACCGTCGTCAATTTCCCCAACAAGCTGTGTGGGCCCACAAATGGGCTGGAAATACTCGGACACAATACCACCGACTGCCCACATATCCCAAATGG
CATACAAACCCATGACCTTGTCAGCGATGATGAACGTGTACTCCTTGGTCGTGAGGAACGTGCCATTGCTGCTAGTTCCGGAGCTGATCAAGTCGTCCAC
AATACCTGCGAACGACTTGCGCAGCGTATCTCGCCTCTTGTATGCCGTCTCCTCGTCCGTTTGGGCCAGCAACTCGTTCATACAGTTGTTCGTCGCGATA
GGGATGTCGTTCAACACGAGGTTGGACTTACTGAATGCCACTCGAATGTCGTCCTCTGGCATTTCTGGGTTGTGCTTGCGGAACTCTGCTACTGTCATCC
ACGTGCGATCCAGCAGACGCTTCATATCGTATCCGCAAGTGGAGTTGGACTCCATGGCGGACTTCAAAGACGTGATTTCCTTCTCACTCAGAGACTTGAC
GGTCTCACCGAGCGAGATGTTCTTCATATACCCAGTGAATTTCTCCCAACTGGAAACGATCGCATCGGGGTTTCGCATCACTTCTCTTAAGACCAGCTCA
GCAGTCGTGACCACTCTGTCAGCGAGCTTGACATCATCTGGGACCTTTTTACCCATACAATACATGACTGCTACTGGGATGTCGATCACCACGTTGTCCG
TTTGATACAGGATCGCAAGCAGCTTTTCTTGTGGCGTCTCGGGATCTTTTGTCTTGACGTAGCGGACGTACTTGATCAGCGACTTGGTGAGACTGAGGAT
GCTCTTGAAACACTTGGTGGCTCGCACGATACCTTTACCCAGCTTGTAGAAGTTGCCAAACACGTTCATTGTAGCGAAAGAGAGCGTCGTCTGGACCACA
GTGATCACTTTCACTGCCACTTCCAACGCGCAGTCGTCGTTCTGACGGATACATTCGAGTCCGCACTCGATAGGGTACGCGTACGGACACTGCGCCCAAC
ACGTCTTGGTCTTTGGATGACTCACAAACCCGACTGGACAAGTGTTCATGATGTGAGCTTCCCGATAGCAAGCGGAGGCAATTGACGTATCCAATGCCGT
GCCAACCCAATTGACATAGGTAGGTTCGATCGTACTGATAGCACCCGCGACACTACCGATCTTAAAAGCGGCATCCAGCGACCCCGCAGTGTCCAAAGAT
CCAGTGGAATCATCATCACTGTCATCACTATCGTCGATACTGTCAGAAGAATCATCCTCACTGTCGTCGCTATCAGAAGAATCCGAATCGCTGTCGTGTC
TGGCGATATCCCGGTCACCATCGTTCGCCAATAACGAGGTTTGAAACACGCTATCGGTTGCGTCTTCGGAGTCGACATCTTGACTATCGGACGAACCGTC
TGCCCGTCTTGGCACCTTGGTCGTTCTCAGTACGCCTCCTTCCGTGAAATTGTCGTTAACCGGCACTACAGTAGCTACTGGGCTTGACGTTCTCGGCCAA
GCGCTAAACGTTAGGATCTTCGCGGATGAGATGCCAGCGAAGATCACCGCGATGGCGGCGAGCAGCAGAGCCACCTTGTTCATGTTGAGGAGGTCTCGCC
TCAGCGAGGAAGCTTGTTGAGCCTCTAGCACGGCAAAACGAGGAATGAGGGACGTCGAGAACTGTCGAAACTCTGTTCTCGAACCGAGTTTTTTTGTTGC
GTAGGCTGTTTTGGTTGGATGGGCTCGCCTACGGGTCATTTGGCAGCAACGGAGTGGCGATTTCACCAGATGAGCATACCGTGTTGTAAATCAATTCCGG
TGGACAGGTAGCGATACATGTCTTCAATCGAATTCGTCCAATCACTGCGGTAAGGATCGACTGTGCTCGTCGACGAATAGCACACGATCTTCCGCATGGC
CATCTGGAGGCAGGACAAATGTGACCACGCCGCGAGCGTCACCAAGGCAAAGACACCACCTCCTCTAGTCGCCTGGATGCTGCACGTTGCTTGAAATATC
TCGTAGACAGCGAGAGACGCCGCGTCTTGTGTCGGGATCCAGAAGGAGATCGGCGTTGGCCGTTCTCATCAAAAGGTGAGACGCGAACGCAGCGTAGATT
CGCTTTCGACCGCAATTTACGACTCGCAGTGCGCTGGTTGCCAGTGATTTTGCTAGCTGCAACTCGACTGCAGCAAAGTTACGTGGTGTGATTGTGAGAT
CATGATGGCGATTTGTATTGACCTTTCCGCTGTTCGATAGCCGGCTCGAGGCGAGTTACTGCAGTGACCTACGAGCGATTGCAGCGTGCAATTGCCAACT
TGCGTATTGCTGCCAGCAAGTGCGGGCCTACAGCGCATCCTCGACGTCTTGTGACGCGTATCGCGTCGTTCGTTCTTGGTGTCTGTACCGGTATCGGGAT
TGATGAAACTCGATGCAAAACGTGATCGAGGTACGAGTCTTGAGCAGGTCCACGCCTGTGGTCACCTCGAAGTTCGACTCAAACTGGTGGAGTGCCCGGT
CTGTTCTTGTGACGGACGTTCCTCCACCCAACACTGCTTTGTGATAAGCGCCGGGGTGAGGCGGAGATACGGAAATACGCTCGTTGCAAAAGACTGCAAC
ATGGTCAACAATATATATTTTAATATTTTAATAAATATCACTTTCCACAATTTCGCTGGGGAGGAATCTCACAGCCACGCATTTGCAGCGGTTGTAGTAC
AACTTGTACATGGAGGCTAGTATTACTTCGAAGTAGTTTTTAAGAAGACCTTGAAGAATACAATAGCTGATACATGTAAGAAAAAATATTGTCATTCATG
AAGATGTCGTAAAACTGACTACCGAGACAAGGACAGATGAGTTATTGGCAAAAAATTCTTCATGGCCTGCAAGACGTCCGGTACATACATCTACATGTAC
AACAAATTTTGTACCACTGCAAGCAAACGAGTGGAAATTGGCCTCAGTATTCGCCAACAAACCCCTCATGAATACGGTTCGTCACGCTGGAACAGCAGTG
CACCGCATTTCCGGTGAAGATCGCAACAACAGGCCAAAGTTCCGCTTTTATGACACTTGAAGCCTTCTCACTTGTACTGCAACTTGTAGTACAGGTAGTC
AATTGTGGTGACGTTCTTGAAGATGCAGTTCACACCAACCACTTGATCAAATCCACCCTGGCCATTCACAACTTACGAATCCCAAGTCCCAA