Description :
From Genome Similarity Track
Location :
Scaffold_791:5591- 11153
Transcript NameFunction/comments
Phyag_g8050phosphatidyl inositol kinase (PIK-A)
Phyag_g8051hypothetical protein

Sequence
5562 bases(100 bases per row)
CCCAACGCGATTTTATGAGCCACATCCTGGCAATTCACAACAAGGCCCGCGAAGAAAAGGGAAGAAAAGACCAAAAGGAGGAGAAATTGCGTCATTTCCT
CAAGCAGTTTCCGTGGCCTAAGGGAGCTGTGATCTCCTTACCCCTCGATCCGACAGTTCACCTAAGCGGAGTTGTTGCCGCCTCGGCGAAAATGTTCAAG
AGTGCGATGTATCCGGCAGTGATTCAGTTCCAGACGGTGATCCCTCCGActgaccagcaccaccacaatgCAATTACCGCTGAAGGAGAGAATCACCATC
CAGCAAATTTGAGCCAGTCAATGTTTGGTGGAAGCGACTCGAGCATTATGCGCGAATCGTTGCCTACCCGAATGATCAGTTACTTGCACCGCGAAAAGGA
AGGACCGATGTACAAGTTTATGGTGAAGAACGGTGACGACCTTCGTCAAGATCAACTGATCATGCAAATGTTCATTCTGATGGACCGATTGCTGAAAAAA
GTGAACCTGGATTTGAAGCTGACCCCGTACCGCATTTTAGCGACGGGCGCCAACGATGGTTTGATGGAGTTTGTGCAAGATTCGTACCCGGTATCGTATG
TGGTATCCCACTTTGAGTCGCCTCAGATTGTGGGGTTCTTGCGGAAGCACAACCCCGACCCAAGCGCAGAGTTTGGCATTGCACCTGAAGCTCTGAGCAC
ATACGTGAAATCAGTGGCGGGCTATTGCGTATTGACGTATCTGCTGGGGATTGGTGATCGTCACTTGGACAACTTGATGATGAAGGCAGAAGGCCACATG
TTCCACATTGATTTTGGATTTGTCTTTGGAGCTGATCCAAAGCCGTACCCGCCTCCGTTCAAGCTGACGAAGGAAATGGTGGAAGGCATGGGCGGTCCCA
CGAGCGAGCACTACCAGAAATTCACGACGTATTGCTGCCAAGCGTACAATTGGCTGCGCAAGAGTGCTGACCTGATTTTGAACTTGCTCAGTCTGATGGC
CGACTCCGGAATCGAAGAGTTGTCGGCAAACCCTGCTACGActctgctgaaggtggaggagaagttCCGTTTGGACTTGACGGATGAGCAGGCAGAACAA
TTCTTCCTGGGTCTCATTAACGACAGTGTGTCCGCTCTGTTCCCGCTGCTTGTGGATTGGATCCATAAGGTTGCAACGAAGTTGAAATAGGCGTCGTTCC
GTCAAACTCGTTCGTGCATTTTACCATCTACTAATGTTCCCTGCGTCTAGCAATTGATAATAAATAGCCTTCCTCAACGGGCTGCTTTCCCACCGCCGAA
TGCCAGTTgcgagctcagcagcacaTCGTTGGCCTGCCGGAAATTCTGAATCACCAGCAACTTCTCCTTTCGCTGTACAACCCCCCCTGTTGCTTCGGCT
ATCGCGATGGCTGCGTCCTGCTTCTGGACGTGTTCGTTGAACTGTAAGTTAAGCATCTCGTTCATCCGAAGGTGTTTTCCCGGCACGGAATTGGATGCAG
GTGTTGATCGAGTTGGGGAATACGGAGGAAGCACAACACGGCGCGAAATTGTCGTACCAACTGGACTGGTTGAACTATGCGCTGCGATAGTATCTGCTGT
GGGCGACGAAATGGTTGGGAGTAAGACGTGTGGAGCTTTGAGGGGGGATCGTGTTGGATCCAGTGGGAAATATCGCTCCAGTTGCTTGGACACCTCGATA
ACGGCGCATACGTACGTGAGCTCTCGCTCGTACGACGCATCATGCAGTTTTTCGGCTGCTTCATGAACGTTTCCAATACTTTCAGCCAGGGCGCAGAAGG
CGACTTCGTCGGTCACTAAAGGTAGGCGACCTCGAATCCGTGCAATGCTCCCGTACAAAGCCTGGCGTGACTCGTAGATCTCTAAAGCAAGCGCGAGTAA
CTTTTCCCAAAACTCGATCCATGGCATTGTCGAAGAAACGTATCCAAGCTGTGCAAATAACAaacgaggaggaagtgaaTACGGTTCAACTGCTTGAGTA
ATACAGCAACAGAGCGACATACCTGCCGAAAGGTATCCATAGACTGTTGTCGACGTGCGTCCAGGCGGTCCTTCTCCGGTGAAAGGAGTCCACTTCGTAT
TTGTGAAGTAGGTTTCAACCGCGCATTCGAACGAGACGAAGGTGAtgcttctcggccttgaTATTGAGGATTGGTGAGTAGTTCGGCCATTTCTTCAATA
GCTGCCTGCTTTCTCGCAAGAAAATCTTCGTGACGCTGCTCCGCACATTCCAGGGAGTTGTCGTCAACCTTACTGGCTTGGTTGTCGGCGACGGCCGCTA
CATTTTGAGGCAAGCTCTCATCTTTGATTACATCGGTCTCTTCAATGGTATCTTCAGTTTTAGCAAGTGTAAGCGActttcgtgctgctgcgatgctgCT
AGATCTGCGGTTGAGCAAGCTGGGCATCTTTGTTGATGTGTTGCccgagttgttgctgtcgatgtCGATCTTCAGACTTTGTCGACTTTTGAAGACTCGC
TGAAGACGGCGTACTGCTTTACCATACAATTCCACACGTACTTCTTCGATCATCTGGGCAACGGACttttgaagcagcagaagaaaacgTTCTTCGTACG
ATGTGCTCAACTCGGCAAGTGGAACCATGGGAGGAACATGTCGATTTGTGGTGCGACCACGTTTGTACTCCGTCATGCATTTGTTGTCTTCGCCCAAAGA
TTGAAAGCAAAGCCCGAGATTATAGTGGATAGCGGCCAACACTTGAGATTGTTTTGCGAAGTTGATTGCAATCGCGTAGTATTCCAACGCGAGCGCGTAG
TCTTCGTGATGGAAACATCTTTCTGCCAGGGAATACCACAGATCGAAATATTGTTCATCTCGCAATGTGGTGTCTTGCTGCAtactcttcagcttcaaca
cggAAGCAAGGCtttgcgctgctgccacatAGTCCCCACTCACTTGCTGGCATTGCATCAACATCAATCGGTAATCTGCAGCATCGTAGTCAGCAGACGA
TGGCATCGCATTCGCTGAAGAAAGAATAGGCATACCCGTTGGCGCTGGTTGATATGgttggtcttcttggagaGCTAGTATCGCGTTCATACAGTCGATG
GCATCCACGTATAGCTTAAGACGGTGTAGTACTTGGAACTGGAGAAACAACAGGTTCGGTCGGCCCTTGTCACAGAAACCCACAAACTGAGAGAACAGTT
CATGAAAAATATCGCGGGTCTTCTCTAGATTGCCGTCACCTTTGTACCAGAACAGCCCAAGCGCATAACGAAGGAGCAACACTGGATCTGCCAAGCTCTC
GATATACGCGAAAGCACTCGCAAATGCTCGAATACTTTTACCCAGATGAAATCGTGCAACAGGCAGATACTTGCGATGCCGCATAAAGATGTTCAGGTGT
GCTGAACCAAGCCAAAACCAGTATTCGTgcgttcctgctgcagttttgtgCAATAGTGCTGCATGCTCCAGGAGTGAAATTGCCGCCATACTTGTACCCG
ACGTCCGTGCATAACGGAGCCCCAGTTTGAGTAAATTTTCTTCGTTGCGCGGGTCCGTTATGACAAGCTCTTCCAACTGCAGACATCCAACCTTCTCGAT
GATACTTTTACCAAGCATCCACCTTCCCCATTTTTTGTGGTAGTTTGTCACACTCTGAGCGACACCTGCTTGCTGGGACGAATGTCGCTTCACTGGTTCT
TGGCGTTTACTGGTACTGTTGTGACGTAGTGCCGGACTGAGATTCTTTTCAGCCGGAACTTTTGCCACTGCTTTCCCAGCAGATGGGGGCGTTACCCCTG
GTAGTACCTTGCTTTGTTCGATCGTACTCGTACGCTGCACGTCGCTAGGAAGATCACCTTCCGTCAGATCCTCGGCTGAATGCCGCCGCCCCACTTTGGG
ATGAGTCTCCGCAATGCTACTTCGACGTCTTGAACCTGTTACTTTCGAAGTTGTCTTGGTTGGTCCAGTATTGTACGGTGGCCCGGGCTTCTTGTTTGGA
CTCAGCGATTTTTTGCGTGAAACCCCGCTTGGCTTTTCACGTTCTTGGATTGACGATACTGTGGGTTGCTTTTTCCGAGCAAGTGGTGATGCTGTGTCAC
GACGCACTTTATTGTCACTAGGAGTGAGCTGCGCTATAGTCAGCTGATCGGTGGGTATCACCTCGCTATCAGGAGTTGGCTGGAGTTCTTCCGCGAAGTT
GATGCTGGTTACTTGGTCGGGGTTATCTTCTCGAGTGACACCGCTATCTTCATATGTTGGCTTCCTACTCACAGGCTCTTCATATGGAAAAACTTTGGCA
GGGTGAAAGGAGCTCACTCTTGAATCACTCAGTAGCAGCTCATCGTTTTCAGAAGATTCTTGTGTCTTTTGTGCACTGATAACTTCATCACTGTCAGGTG
ATGATGCAGTAATCTCGACTTCACTGTCTCGAGCGGAATAAGTCATGCTAACGTCGCCTTGATCTTTGGAGATGTCTGGAGAGTTTTGTGCTTTGGTGGC
ACAATTGTCCTGGTCTATTAGCTCAAGCTCACCAGTATTCACCAGCGCTCCAACAGCATTACAATAGCTGGTTTCAGTCGATTCACCACCAAAACCACCA
ACAATGTCCACGACACCCTTGACTTCTTCAATCTCGTTGACAACGCATTCTGCACTATCAATGATATCGGGAGTAGCATAACCAGGAACTGCGTCAGAAT
CTGCCAGAGTATCATTAGTGCCAGTCTGGATATCAGTATCCAAATCTCTTTGAACTTCACTGTCACAGTTCGATGCTTCACTGCGTTCTCCACTCAATTG
TGAAGGAGTTTCACCTCCCTGACTCTGTTCATCGGTCTTGGTACCCTCATCCAAGCCTTGTAGTCGAATTGGGTCCACTTGTGGTGTGACGCTCGCGCAG
TCTTTTAAGCTTGGAGCATGCTGCTGAAATGGTATGCTAATCACGCTATCCGATTGTTCTTCATGCGCACCGTAGTCAATGTCAGACTCCGTGGGACTTG
CTTTCATTGGTGCTGCCGTGCCTAATAGATCTTCAGTCGCTTTCTCGTGTGCTTCGGATAGTAATATTACAAGGTCTGGTTCTTCCCAACATCCTTTCCG
AGCTGAGGGCGGAGAGATCACATCGTCCTCAAAAATTGCGGGCGAAATCTGCTGGGAAGAATTTGGTTTATCTTGTAGCGATCCTTCATCATCAGCTGTA
GCGGTGTTCATTGTAGGCATGTTATCACTTTCGTTTGCCCGAATATCATTCTGAAGCTCCCGAAAACTCAAGTTGTTGACTGTTGGTTGATCCTCCACAG
TTACTTCGCTCTTTGCTGTAGCAACTCCTTCGTTCACGTCGGTCGCCTCATCACTAGGAGGATAAAGCACAACTTCAGGATCTGATGGAACAACTGacac
ttcctcttcttgaacaacttcaacttcgggGCAGTTAGCATTCGTAGGAACactagctgctgctgattccTGTGGTGCCAGAAATTCCTGAACGGGCGGT
TTAGTTGCTGTGCTCGATAGGGGAGCTAACCGAATAACTCCTTCAGACCCAACAGAATTTGA