Description :
From Genome Similarity Track
Location :
Scaffold_92:55904- 57523
Sequence
1619 bases(100 bases per row)
taatgtaacgaaacgacgtactttgagttgtatttaatttaaacatgctatgtcctcaaacatgtcgtcaaaatcatcacctaaagtaaattccccaatc
agttcatccagtaaacccgttctagtagctttggctacgatgtcgcttgcaccttcagcctggacgtgttcttcttctgcgtcattggtggagaggaaac
cacactttttaaagccgcccgtaattgtcgtaggagagatgttttctcaagcaaagttgacccagctgcataattgacgtcggtctggaggttctagctt
aaacgattggccagggacacgggcaactagctgatcacgtagatcttcaatccagcgattccgtagtctggttttcagtgggccattccatgtagcatcc
gctggttgtgacactgaggttgcattcggagggaccttcataatggtcacgtcgatagacccagcgtacctgacgacttcactggtccaatgaccagaga
aatcgccaagaagcaaaagtatagggtcttggggtgctgggcggcttccaaaatgaaattttaaaaactcaatagttaagtaataattccaccaacctaa
catacaaagtataaataccgttagaatattttttaaagatgaattgaacagcccacctttttcgttcgcgtaaatttgcatgttgtactcgtcttgcgag
cgggcaataccatttcggcacatcccaggactaaatccatgacgcaacgacgtatttccttctcgcctcttctccagttttgatgggcgcactttgaata
caacaaacggatcatatttcgtacccgatgagtcaccgagaagcattactgtagctctgttctttgtcttgtttccacaccgaacccacaccgttttact
tcctgttcttgctagtgtcttctttggtagatactcaaaacaagcggctaaaaatatacaataagaacgttaataaaaataaataggttaaaaaataaac
aaaattatacctgtttggtctgcgttaaatatacgcttcgcaccaacctcggctgcctttgcttatacctctttggcaaagccagctgcaattttttcca
gttcggacggccgaagctgaccttgccgtgtcctacagagtagcgagagtcggtggcgcttcttgaagtgtttttgccagcaccaagacgccttaaattg
cgtgattgcggcctctttagccatttcttgtgcttgaatgcgcaacatcgttgttgtgatgggcacaccttctgcacgcatttcgtttacccatcgcact
aacaatgcctcctccctttccggcaaaatggtacgccgcaagccttgcgcttattagctccgttcttctccaaattaagcttctcgatatcagacagaat
tagagtacggcgactgtcaaatttgtcagatgacaagtccgggtagaatgagttacgatgtcgttctgctccgctaaatgattgagaacatgcagcttct
catcggccgtatatgacaccttcttgaactttttctttgcgcgcccactgccgtcgggcagacgaggccgtccttttgggcgatgacgcgaatccatcaa
attgcaaagtaaaaattgc