Description :
From Genome Similarity Track
Location :
Scaffold_308:5588- 9362
Sequence
3774 bases(100 bases per row)
GGAGCCGATGAAGACTCTCTGTTGAGATGGTTCGTGGAACTAGACGATACCATAAGGGCTCGTCATATCTTCGATGAGGAATTGCAGATCGCATTTGCTC
AATCGAACTTGGCAGGGCGTGCAAAGACGTGGGTCTTGGGCCTTAAGTTACACGACCCATATGTCTTCGGGTCGTTGAAAGTCTTCAAGTACCTGCTTAG
GCAAACATTTGAGCCGCCGTGAGCTGAGTTCAGGACTCTCTCTGAATTCCTGAGAATCAAGCAAGGTAAACGTGACGTACACTCGTACATTCAGTACATA
CGTCACCTTACCAGTTGCATAACAGTCGACCCACTGAACCAACAAACGTTGATTACGTTGTTCATGCAGGGTCTGACTGATGGTCCTATTAAAACATACC
TGTTCCGATTGGAGTTCAACACCCTAGAAGAGGCAATAAGGGTTGCGGAACAGGAGGACTTCAGCGTGAAACAGGCTCACGCGAATTCGAATTCCTATCT
TCCGTCGAGACGACAGGAAAATGGAGGCCCAAGAACCAATGGACCTCTATCACGCGAGGAGCGAGAGCTCTCGTGTTAACAACTACAAGAAATTGCAAAA
ATGCAATAGATTTCAGAAGACAGGGCATTATACATATGAATGCAGTGCCCCGAGCGCGGTACTACGTACCGCAGGAAACAGTAACCTCCAAGCGGCCAAA
CGAGGTCCAAGGCGTGGGTCCAACGTTGTTGCGAAAACGCAACAACGTGACGGACAGCCAAAAAAAACGGTCAAGGTCAGTAGGTGCAGAGCATTCTACG
GATCCAGCAACATTAAGTGATGTTTGCAGGCCTCTTGACGAAAGTTTCTCCCAACACTCAGTCATTGTGTGTTAGCTGGTAATGAAGACTCCCTCATTAC
CTTGGAACTCGAAGTGACACAAATCATGTCGCTTCGAGCCCTAGTCGACTGTGGGGCGTCGAACAACTCTGTACGACGCCAATCGCTGGACAAATGAGAG
ATCGAATATGTTGAGCGAGAGATCCCTCCAACGAGGATGACGGTGCGCCTCGCGACAGGCGCATCTGTAACAGTGATGAGACGTGTAGTGGGTATTACCT
ATACACTGAAGGGGTCCAATATAATGATGACTTCGTTATATTAGACTTGGATGACAAATTTGATGTCAACCTTGGACTGCCGTGGCTCAGAAGTTACGAG
CCACAAGTCAGCTAGAACCGACGAACAGTCGATATGCCTGTCACTTGTTCATCAGATGGCCATCTGATGAGCGCCATGGAGCGCCCACTAACATGTGGGT
GTACTACGAGCGAGTGCGATGGCCTCGCGTGTGGTTCGGTCGTTAGTACGACTGCACATGGCCATGGAGTGGCTGATTGCCACACCATGAAGCCAGATTC
CGGTGACTGCATTGAGATGCAGGTCGCGCCGAAGGCCCACCACCCGAATAAGTCGAGTGGACTGGGGCATGGGTGTCCTCCAAGCGGACAACACCCACGT
GAAAACGAACCGATTGCCAATGATTGGCAATACGATGATCTTAGTGCGATTGGAGAATCGCACGTAGAAGACCTAGCCGCGGTAGCGCAACCACCGCCAG
AGGATAACGAGGGAGCAATTCCACTCGTGTCATATGATGATAGCCCAAGAGGCTAGTGAGGGAACAAGTCCCCACCCAACTATGGAAATAAGTTCCCAGG
AGACAACAGAGACAATAAATGTCCTAGTCAATGACGGATCAAGCATAGGAACTTATCAACTTGATCTGATCGCGCCTCCGAAGACAACTTCGGAGATCAT
TCAATTGCCCACGCTCCAACAGAAAAGGTTCTTGCGTGATCTGCATAGTGGCAAAGTCAAGCAGATTTGCGTACTCGTCGCGGAAGACGAGTACGTAACC
GATATTCGGTCGGCAATGGTATTCGCTGAGAACGAACGGGTTCTCAGCGGCTTATCAATGGACGAAATTGTCCTTGATGAGAAGACTCGGATTGAGCAAT
ACACATCCCAATCGTGGGAATTGCTCAAGACAAATCCTCTCTACGATGATTTGACGGAATCCAGAGATGTGTTACCAGAAACAGTGCCGTGCGAGCTACC
CAACGATAAGGAACTCGTCATGAGATCGACCTGAAGCAAGGTTCAAAGTACTGTGTCATGAAGCAATGGCCATTGCCTCGTGAACAAGTACTAGCGATTG
ACAAATTCTTTGCCGATCGCTTGGCAGCGGGCCATGTGAGGGAATCTACTTTCTCACATAGCTCTCCGACTTTCTGTGTCCGAAAGGCCACAGGAGGATG
GCGGATATTACATGCCTTCAACAAGTTGAATGCTGCCACTGTACCGGCTCAAACGCCGATACCAAGAAAGGATGTCATTATAGATGGTATGGCAAGGAGT
ACCATCTTTTCATCGATGGATCTGAGGACGGGTTCTATCAGATCATTATGCGTGAAAGGGACATTCCTTACACAGCAGTGAGAACCCCAAGCGGTATGCT
TTGGGAGTGGTTAGTAATGCCTAAAGTGCTGAGTAATGCCCCTGCTACGTTCAACAGATGCGTTATGGATCTGTTGAGATCTGTGCGAGAATTTGCACCT
AGCTATTTCGATGACATGTTCGTCCATAGCCGGGCTATGGATGAACAGACGGATTTGGAAGTCCAACGACTCCACGTCCGAAAGGTTCTTACACTGATGC
GTGAGCATAAGTTGTATGCCAACCTCGAGAAGTGTATATTTGCTGCAAGCGAAATACCACTTCTTGGTTGCATCGTGGGTAAGCACGGCGTCCGGCCCGA
TCCGGAAAAGATCAAGGTGATCACTGACTGGCCGGTGCCTACCGACGTAAAAGGACTTCGAAAGTTCCTTGGTCTAGCGGCGTATTTGCACAATTACTCG
CACAATTACGCCGAGATGACTGTTCATCTCTCTCGTTTATTGAAAAAGAACGAGAAGTGGACATGGAGTGCTGATTGCCAGCGATCCTTCGAAGGTATCA
AGCGAAGCTTTATACGCTCGCCAGTTTTGGCGATTGCAGACCAAGACAGACCATTTCATGTGGTCTGCGATGCAAGTGATTTTTCCATCGGATATGCACT
AATGCAGTACGACACAGACGGTGCTGAGCGTGTCGTCTACTATCAGTCACGTCATCTGCAACCGGCTGAACGTAACTACCCAGTCCATGACAAGGAACTT
CTTTCCATGAAGTATGCATTGGCGAAATTCAGGGTCTACCTACTAGGTGATAGACCCTTCATCGTGTACACAGACCATGCGTCCTTACGTACGGCCGTCA
ACAGTCCACACCTCTCGCAACAATGGCGAGGTAGCTGTCGTTCTTCGTGGAGTATAGCTTCTCCGTGGAATATAATCCAGGACGACTGAATTTAGTCGCT
GATGCTCTGTCGCGCCGGCCCGATTTCGAACCGGCTGCGCAACCCGACACTGGTCCGACCACTGTCGCGGTGTTTACGTCAAGTGTCCCATCGTCAACCT
TATTCGAAGCCTTACACAAGGCGTGCGATACGGCTATGGTGCGTTTGATTGATCATCTCTCGCAACCATCCCGTCAATCCCTAAAAAGGTTGCCCCCAGT
ATATCGATCCTTCACGGATAGATATATAGTTCACAATGGCTTACTGAAGTACACAGCCGTTGCCGGCGACACGCCTCGTGTCGTCGTACCGGACCATGGT
AATCTGTGACTACGCATCATGTATGAGTACCACGATGCACCTACTGGTGGACATCGTGGTCGAGAGAAGACATA