Description :
From Genome Similarity Track
Location :
Scaffold_63:55874- 57456
Transcript NameFunction/comments
Physo_138389hypothetical protein

Sequence
1582 bases(100 bases per row)
CATTTGGACGCGCAACGCACAAGCCAAGTGTCCACTACGCACCAACTCACTAACTCGCTAGACATGCCGCCGCACCCTGACGACGTCTACAACGAGGTCT
CCACGCCCAAGGCCGACGTCGCCTTCGACGATGCCAACAAGGCCGCCGCGCTCCAGATCAAGCCCAACCGCATCCTCTACACGAGCGTGCTGCTGGCGCT
GCTGCAGCCCTTCCAGAGCGGATGGTCCACCTCGCAGCTCAACCTGTCCGACTACAACAACACGGACGAGTGCAACGCGCGGCCCGTCGTCCCGGGCACA
TGCACGCTCTTCAGCGGCCACTCCAAGCTCGAGTGGACCTTCGCCGTGAACGCGTGGATCTTCGGCGCCATGTGCGGCAGTCTGCTCTGCGGCTACTTCA
GCGACATCATGGGCCGCAAGAAGCTGCTCTTCTTCAACTGCTTCTTCATGTGGTCGGCGGCGCCGTCATCCAGGCCGTCGTCTCCAACATCTGGCCCTTC
GCCGTCGACCGCATGGTCTCCGGCATCGCCTCGGGCGCCGCCACCGGCACCATCGGCGCGTACGTGAACGAGCTGTCGCCGCCGCACCTGCGCAGCCACC
TCGGCCTGGGCCTGCAGATCTCCACCACCATCGGCATCTTGGTGCCGGCCATCTGCTTCTTCTTCGCCGACAGCGGCGATGGATGGCGCTACATGGCCGG
CTTCCCCATCGTGCTGGCCGCCATCTACATGTTGCTTTCGCCCTCGCTGGCCGTCGAGAGCCCCGCGTGGCTGCTCATGAAGAACCGCCGCGAGGAGGCC
AGGCAGGTCATCACGCGTCTGTACGGCGAGGAGCACGTGCAGACCGCGCTGGGCTGGCTCGAGGCCAACAAGCAGCCGAGCGAGGCCGAGGCCGGATACG
CCGCCAGCTCGCAGCCGGCCGAGTCGATCTGGTCGCCCAAGTACCGCCTGCAGTTCCTCGGCGCGCTCCTGCTGTCCTGCACGCAGCAGCTCTCGGGCAT
CAACGCCGTCTTCTACTACTCAGGCAACATCTTCTCGGACGCCGGCATCTCGGACTCGCGCGTCGGCACGCTCATCATCGACTTCATCAACATCTGGCCG
GCCTTCTTCACGGGCGTGCTGGCCACGCGCTTCGGCAACCGCAACATGATCCTCTGGGGCATCGCCGGCATGGTCGTCATGTCCATCGGCATGACCGTCG
CCTTCCTCGTGGACGTGTCGGCGCTCTCCATCGTCTTCACGGCGCTCTACGTCATCGTCTTCGGCGTCACGCTCGGGCTGCTCGTCTGGGTCATGACGGC
CGACATGTTCCCGGACTCGGTGCGCGCCAGAGCCTCGTCCATCTGCATCGGCGCCAACTGGCTGTGCAACCTCATCGTCGGCGTGGGCTACCCGTACCTG
GCCGACGCCTTCGACGACTGGAGCTACACGCCCTTCACGGTGCTGCTCATCATCTTCTACTTCCTGTCGCTCATGCTCGTGCCGGAGACGGCGGGAAAGA
CCAACGAGGAGATCCAGGCAGAGTACGAGGAGCGCCGTCGCCGCTAAGCAGTCGTCAGTGTCGGATAGTGTACTGTAGCGGG