Description :
From Genome Similarity Track
Location :
Scaffold_541:5587- 7836
Sequence
2249 bases(100 bases per row)
AGCAACTCCGGTAAATGTTTCATCGCTTCCAAACCTGGTATTACTTCATTAGGCGTCGACTCGACCCCCTCTTGCTGATGCAAAGATGTACTGGCCAACT
AGTCCGCGCTCCGATTCTATCTCGTTTTTCATGTAAGATCATTGGAAGGGCCACTACTGGAGTTCAATTAAAGCCCGGGCTCGTAGCGGGGACAGTACCG
AGGCTTTACACTCAATCTCCCCACGCATCTGCCGCACCACTAAATTGGAGTCTCCACAGATAATCAACGCCGTTGCTCCAAAGGTTTCAGAAAGTTGAAT
CCCAGCAACATATCCTCATATAGTGCCTCATTTACCGTAGATGTGTCGAGGTACTTGNNNNNNNNNNCTCTACAGATAATCAAAATCACCGTCGCTCCAA
AGTTTTCAGCAAATTAAATCCTAGCAACATACATTCTTTTTCACCTCATTTACCATAGATGTGTAGAGATACTTGGAGTTGGCTTCGACTATGGTCCATG
CTAGGAGTCTCCATACGATAGCGCTACAATCNNNNNNNNNNCATGCTGGGGACCTCCATACGAAAGCGCTACAAGCCCCACCTCCTTTCTTAACACGGGC
TGACCCATTGAAACATTACAAACGTCCTTCGTCTGGTTCCACGGTGGGGGTAGGTAGGTAGATCGTCCGCCTTACCTGCTCCTTAGGGGAAATGGCCGAC
AGTATTGAGTATACAATATCTAGAGGGGTAATACTGGCTGACAATGCCCCCANNNNNNNNNNGAACCCATTGGAACTCATTACGTACAGTTCTTCGTCTA
GTCCGGTGGGTAGGTAGGTCGATCGTCTGCCTTGCCTGCTTTTAAGGGGCAATTGCCGACAGTATTGAGTCTACAATTTCTCGAGGAGTAATACTGTCTG
ACAACGATCCCATCACCTGGGTTCGGTGACAAGAGAGCGGCCCAATTTTTAAGTGTCCCTGCAAGCCGGCAGATTTCANNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGCTTCTCTGCTCGGGTCAATGTGTCTCATAATTGTTGTCGTGAAACGTTATTCTT
AAGTATGGCGAAGGCCACTTGAACACGGGTCCAACCTTCTTCGTTTTCATCCTGGGTGGTGTTATTGTTATCTTCCTTCAGCTGGCTTCGCCGTGCATAG
AAATTCACCTCTCNNNNNNNNNNGCGAAAGCCTATTAAACACGGGTCTACCGTTCTTTGTTTTCGTCCTGGATGGTGGTATTTGAAGAACTTTCGGCTTC
TGTGNNNNNNNNNNCTCTGGTCGGGTCGAAATGTCTCTGAATTCATGCCGTGACAATTTTATTCATGNNNNNNNNNNAATAAACCTTCTTTAATAAGGCA
AGCTCCCCAGAAAAGATTGCATGGGTTCAGTGCCATTGGTAAGGGTAGGTCGACCAGAGATTGAAGGNNNNNNNNNNNNNNNNNNNTACTCGATGCCCCA
AGGTAGTCGACCGTCCGACATCCCCATGAACTCTTGACTACGCTGATCTACATATTCCAGTAGTCGCACACATCCAACGGCTGTTCCACCTTTGCGCACA
ACGCATTCCATGATTCATCGGGGATCAAAACGTTATCTATGTATGACCGCCAATCCAGGATCGAGAAAATCGCTTGCTCATCTGGCTCTCCCACCTTGAA
CNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTCTGTCTCTGCTCCTGAAGAAATTCGTAATAGACCATATATAGCGTTTTCCAAGAGTAGCTG
ATATATTTGTGGCGCATTCTTGAGCCCANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTCCCAGGTCTTCCAATCATTCATTTATCAGAGGCACGGTGTAGACCATGAATTGACTTAGGC
CATTCACCAACCTGTAGTCGATGCACAGCNNNNNNNNNNAATCCTTTTT