Description :
From Genome Similarity Track
Location :
Scaffold_455:5586- 9969
Sequence
4383 bases(100 bases per row)
CTCGAACCGAGAGTAATCTTCACCTGAGCACTGGCACCGATGTACGTCGGAACGCCTCCCATGCCAGACACCTTGGTTTGCTTGTGCGACTTGAGTGTGA
GTCCGAGCTTACGCGCTAAGTCGAAGCTCACAATATTCACAGTCGCACCGGTATCCAGGAGAACTCTCGTCCGGCAGTCGTTCACAGCACCATGCATCAT
CGCCACATCACGTTTCTTTGGGTCAGGATCATTGTTTTCCCACCATCCGTAGCGCTCTCCAGGGTTCAGCTTGTACTCCACAATTTCTTCAGAGTTCACC
GACCCAGAGTTCGCTTGTTCAGGATGCTGATTTTCAGGGAGAGTCATGAAATCCTGAGTCAAAGTAGTCATGCATTGTTGGTTATCCTGGGTTCTTGTTC
TCAGCTCCGGGCCTACATACACTAGAACACATAACTCTGGGGCCTTCTTCAGCCCGGCGCGTACTGGGTCCCCACCCAGCGGGCTTATTGGTTCGACGGC
CTCCCAGAGTTTGCTTCGCCATCCAAGAGTTTATCCAGGATTTGGCTCGGCATGTCCTTCAGTGCATCTTGGCGGGCGAGTTTCTTCACAGCTTCCAGTG
TCTTCCAGTCTTCACACGGTTTCCCGAGATGCAGTTTGCCACAGTTCTCGCGCGACACAAGTGAGTCGGATGACCCGCTTCCAGGCAGCGATCACACTTC
ACGTCTTTCCAGCAGTTTTCCTCTGGGTGCCCGCACTTGCCGCACTTCTCGCAGAACTTGTCCCAATTCGGGTTTTCGCGGCGAGGGGAACGGAATCCAG
AGTTCGCGTTCGGTCCTGGTTGGGCGTTCGGTGGACGCCATCCCATGTTATCCATCACGCGATAGACCTCGTTCGTCAGCGTCTGAGTCCACTCGGCACC
CTTCATACTCGCCAGACTCCCACGCTAGGCGTAGAAGCTTCTTCTCCAGAGATCTCACGAGTTGACCCTGAATTCGCGCTCGCACTTCGGGCAGAAACTC
TGGATTCGTCCGTGATTTCCTGGAAACGCGCGTGAATTTCAGGGTCTTCGTCTGACTCAGAGTCAGAGACATCGCCCCTAGTCACATACGCACGTCCTTG
TCGCTTCGGCTTGAAACGTCCCTCAGGAATGTTGTCGGCACGAAAGTCACGAACTCTGGGCGGCGGAGCATCATGGTCTCTGCGGCTCCAGACATCTTCG
TCCTGTTCCAGAGCGTACTCTAGATCAGCGATACACCTGGATCTCTGGTCCTGCAGCGACGTCTTGAGGCGCGTGTCCCTGAGTTTCGTGATGAACCTCC
GGATGTGTTTCTCCAGGCGCTTCGAAGACTTGCGAAAGTCAATGTCAGCCTTCCCAGCGGCGGAATTCAGACGATAAAAGAAATCCAGGGCGCTCTCTGA
GTTCTTCATCTCTATCGTGAAGTAACGTTCAGAGTACGACGAGCGCGCTTTGCAGTACTTCTTCCTGAATGCAGACGCCAACTCCTTCCAGTCACGCTGA
GTGTGTTTGGGCAACTGGTTGAACCAGTCACGCGCAGCTCCCGAGAGTTTCAACTTGAGTTCCTGAATTCGCATCTTCGTAGACCAACCTCCCTGAGCCG
CCATGTTCGCAAAACGTTCCCACCAATGCACGCGTTCCCTGAGTGACGCCTTAGTATCGAACTCACCCAGAGTATTCGAGTTGATGTACGGTCTGAACGT
CAGGAGCGTAGTGCCAGCTTGAGCCGTAGAGGCCGTCGACAGGTTAACCCCAGGGTTCCCATCCGAACTGTCATCCGAACTCTCAGAGGACGAGTCATCA
TCGCTGGAATCGGAGCTTGGGTCTGCGTCCGAGGGTGGATTGACATCCTGACGCTTCTTCTTCTGCTGCTGGTGTTTCTTGGGTGCAGAGCGCTTGGAGT
CTGTTTTAGAGTCCTGCGAGGCATTAGAGGTCGCTGTTCTCCTGGGATCCGACGTCTTCCCCAGAGACACAGGCTCGAGCTTGACGTCCTGCGTCACCTT
GGTCTCCGTAGCGCCATGTCCCCGCTTGACGCGCGCGATTCTGCCGGAAGTGTCGGCGGGAGTCTGCGCGAGGGTCGCTCTTAGCTGGGAGGCGGCGACT
TCGGACGTGTTCTTCGGATCAGCTGTCTCCCGTCTCTGGCCTGTGACACTTGCGTTTCCGTTGATTACGCCACTGGATTCTTGGGGTCGGGTTGCAACTT
CAGGGTTCTGAGCCACTGACAACCTCACATTTGTTGCCAAATCAGGGGCGACGGTTGCGCGACGCGCTTGAACTTGGGCCAATGTTGCCCGAAAGTCGCG
CACTTGGCCGGCGTGGAAGCGCTGGATATTCTCGGAAGACTCCCGCTCTCGCTCTTTCTCCGCCTCAAGTTCTTGGACCTTCTGCTCCATTGTTGACATT
TGTTCCTTCCAACCGGCGTAGGTCTCGGAGACCCAGCGCGCGCGCTCCGAGTCGGCTTTGGCTTCGTGCCGTCGCCAGCGCTCGGCGTAGGCGGCATCCA
GGCGCTCACGCTCAAGACGTACAGCTTCCGTGATACTCTGGGTCATCCCCTGAGTTTCAGTGGAACTTTGGGTCTGGCGAGCCTCCACGTCCTGCGCACG
CCGTTCCGCTTCTCCTCGGGCGATCTCAGCGTGGACCAAGTGATCCGTAAGTTCCTGGATCTGGCGACGCGCGTCCAGGTTACGTTGTTCCCTGAGGCAC
TCGCGCTCCAAGGCATCCAGGCATTCTATGGCGAGAAACTCGCGTTGCTCCTGTTCCATGCGGGCCTGCCACTCCTGCTGTTGTCGCAAGACGTTCAGCT
CGATTTGGGCGGGCCCAGACCTCGCGGACACGGACGAAACTGACCCAAGATTCCTGGATCCACTCGAGCGGCTCGACGCAGATGATTTTCTGGATTTCGT
CGAGCGTCGAGAGCGCACCTCGCTCTTAGAGCTCTGGTGTTGACTCCGCTCATCGGTGCTGACATCCCTTGGACCACCAAATCTAGCAATCGGGACAGAA
ACCCTGAGTTTCGGCTCGGAAGTCGTGGCTGAAATCCTGGGGAGACCGGTCTTCCTGGGTGCGATCTCTGGGTCAGAGTGCACCGACGATGCCATCTCAA
CGTCATCTTGGTCGACTGACACAATACGCGACGGGATGACTGTCCGGGTGACCTGAAATCCAAGATCACCGGCAGCTGCAAAGCCACCGGCGCTCTGGGC
CACAAGCGCTAGAGCTTCAACTCGTTGTCCAAGCGACATCATCAACGAAGACGAAGAGCTACCATAAGACGTTTGAACGCCCGAGGCAGTACTCTCATCC
GAAGCGCGCGAGGTACCGATGACATTTGGCACCGCGCCTGGGGTAGCGTCCTTGGCTTCCGCCTCCAGAGAATCACGTCCATTGGACATGGAATTCAGGG
GAGTGGAATTCTGAAGCGAGGCACCAGTCGAAGACTTGTACGCTGGAAGAGAGGACAGCGACGGTGTAGACAGCGCGGATGGCGTTGACGGGACTTGTGG
CCGAGGCGGTCCATGCTGAGTACGCTTGGATCGTGGCTCACCATCACTCGACCCTCGTGGGCTCCGTGAAATTCTGAGTCCAGTGACTCTGAATCTCAGG
ACAAACTGTCGGCCCAGTAGATCCGCATCGTAGTCCGTCATCAATAGATCACCGTCTCCATCTTCCTTGTGGTAGTCCAGTCTTGGTGGTTGCTCTTGGG
CGCTTGGTGCGGCGTGATCTTCAGAGTTTACCTTGAAATGCACACCAGCTATCACCAATCTCCACTCGACCAGTTCCACACACAGCGATGAAATTCTGGG
TTTCCTCCATGACAGAGCGCACCAGACTTTCTGGAATCCTGGAAGCACGCGTTGAAGACCAGCCAGGGATCAAATTGACAAACTCAAACCCGGCTTCGAA
GAACAGAGTCTGCAGAATGGCGACGCACTCGCGGGTGGTCATGATACTCTGGGGAATCGTAGTCGCCATGAGATCCTGAGCAGTTCCGACGCCCCACCGG
GCGAGGTGAAACTCAGAGATCCAGGCTTCATCTTGATTCTCCAGAGACAAACGCCACTTGAGGTAGTCTCCCGTTGCGTACGCGGCCGCGAAGTACGAGT
TGGCATCCGGTTTCGGAGTAGGCCACTCATAAACGACAGTTGGCGGCGTCACCTTCCCAGGATTCACCTCTTCCCAGCGTCGAACTTCACGTCGAACGTA
CAGCACCATGCTCCCGGCGTCCAACGCCGCTGCTCCCGACTCGGGAGCAGGCGCAGCAACTTCCCGGATGTCGCTTTCAGGCGTCTTCCTGGTGCCGCTT
GCAAACTTGGCGCTGAAACTCTGGGTTCAGGTGGTGCGAACCCAGAATTCACCTTGGAACTCTGAGTCTTCGCCTCCTCCTTC