Description :
From Genome Similarity Track
Location :
Scaffold_7:558485- 563906
Transcript NameFunction/comments
Sappa_CBS223.65SPRG_02937Hypothetical protein
Sappa_CBS223.65SPRG_02938Hypothetical protein
Sappa_CBS223.65SPRG_02939mitogen-activated protein kinase, putative

Sequence
5421 bases(100 bases per row)
TTGGTCATTTCCGAGGCGATCGTCGAAAAGATGGCCATGTCGGCTGGCGCCGGGGCGCCTTTGGGCTGACACGCAAACGGAATGTTGACGTACTTGCCAA
ACGCGTGGTAGTTGAGCGCGGTCGCTACCGAGTGGTTGGCGACAAAGTCCCGGATCGCGCGCGTCTCGGGCTCGGAGAACGCCTTCTCTCCGCGGTAATC
CTAGTATCAATGTATCAGCCCCCACCGAATACTGAGCCGCTACCTCGGCACACGCGTCGGTGCTGCTACCAACGGTATCTTGGTCGAAACACACGTCGTA
GTTGCGGTTCAGGTCGACGCCAACGTCGGCGTTGGTCCGACACGTTGCCGGTCGCCGGTTCTTGCGCTGCCCCGAGTAGCTCGGGTTCTCAAAATGCAGC
GTTTCGAGGTGCTTTTCATTGTAGACGTAGCCATCCGGGTTGACGACAAGGACAAACCAGAGCTGGCGCGTGAGGAGGAGATGCAACACGTTCGGATCGC
GCTGGTGGAAGCCGAGAAGGAGGTACTCGACAAAGTACACGAGGTTCTACGCCATACCGAATGAGGCAACCAATGTACTACTAGGCGGTCACTACCATCA
TGGACATGGGCTATAGGGACAGTGTGAGATGAAATACCGAGGAAGGGTCCTACCTCGCGAGCGTGGTGCAAGCCGGTGTAGAGCGTCTGGGGCGGTGTCT
TGCCCTGTGGGTGGCACTGGCCGAGGCAGAGCGCCCGCAACGGTCGTCCTTCCAGCGACGTGCCAATGTCGACTTGCTGGAAGAGGTACGGGAAGGACCG
CAACCGCGCCGGAATCGCCTCGACATACTCGAGCACCTCTGAAAACGAGAGCGATCCGCGCAGCGAGCCTTGAGGCACCGTCGCTAACGACGCATGAGCT
CATGTTGCGCAAGCAGAAGGAGGTACGTAAAATGGCCCGCGTAATGTAGTTGCTGCAGTCGCTCGGGTTGGTTGTCGACGGCGTGCAGGCTGGCGACGTC
TGCTTGTAGAGGCTAATGTCGGACACGACCATCGACGCATCGATCGTCACGTTGTTGCTGTTGCTGCTGCGGTGCGATGTCGCGTTGTCGTAAGCGAGCT
CGACATGCACCGTGTACGTGTAGCCTGCGGTCATGGCGAAGAACGACGTCCGATGCTGCTCGAGATAGAAGACGTCGTCGACGAACCAGCGGAACCAGCC
ATCGTCCCACGTGACCTGGAACGTATGCGAGTCCAGTGTCAGGTCCTAGGAAGAGCAGAATCAGCGAATACATCATGGCATGTAATTTCCGTCTCGAACG
TCAATGCATGGAAAGGCCTTCATGTGCAAGGATGCCGACGTTGCGTGCGGCCAGCGGATCTGGAGCCCGTCCGGTTGCTCGCCAACACCGCTGAGCACGA
CGACGTCGCGGTGAATGCCGTCCTTGGACTTGACAAGCTTGACGGTTGGCCGCAGACCGAGGCCCTAGACGCCATACAGCTTTGGATCATACGGCGAGGA
CGCACCTTGGCCAGCGTCGCCTGGACGACGAGCTTGCCGCTCATCGGAATGTGATCGCGGGGCACAGGATATGTGGCCCAGCCTGAGGCGACGGCGCCAT
CAATCGTGGTCGCCGAGAGCGTGAGCGCGTCGCGCGTGGCCGAGACATGCGCCGTCGCCGCGTCGGACGTCTCGAACGCGTCGAGCTTGGCCGCCCACGC
GCGCTTCCAGGCGCAGTCGCCCGTGCCCGGCGTGCCCGAGACAGCGGCCTTGGTCGCATTCGCGGCCTCGTGCAGCGGTCGGCCGCGGGCCAGCGCCAGC
GCGCCGAGGAGCCATGCCAGCCGCCGCATCGTCGTCATCGTCGCCTATCTACACGGTATATTGCGACACTCGATAATTGGAACCCGGAAAAACTCCGATT
TGTGATATCTGGAAATCGTGTGATATTGTAAATAGTGTTAAAAGACATCTTGCGCTCACAACTGCGAATCGTCGACTTTTGCTGAGGTATTAGTCGCCAA
GAGGTCGTTGCATCGACAACGCAGAGACTGTCCCAGCGTACGACACGGTCGACATTCGCACGTGTCCAAGGTCATACTAGGTGTGATTGACGATGGATGG
AGATGACGGCCAAGCCAACTGCCCTACCCCTCTGCCCACCTTGCCAAAGCGTCGCGAGCCTCCTGTTTACATAATCCCGAGCCAATTTGATGAGTGGCAA
ATTGGTGCTGTCTTGGAACGAATGCAAGCTTCAGGGCTTATTGCCCTTGAACGAAGTCGAAGCATGGGCTGCTCATGGATTATGACCTCGGGTGGCGCAG
TATGTACTATTTGGTGTTGGGAGATTGCTGTCACCTTTAAACTGGTTTACCACGAGGTAGAGCCGGCAGTGTTCCTCTTCCCGACTGTCCCGACCTCGGC
GCCGCCGACGCACGACGGATCTCGTTCGTTCGAGTAGAGGGAAGGCGATGCAAGAGATATCGACAACTCGAGCCTTCGCGCCGGCAAAAGGGATGCTTCA
AGCCCAAGGGATTCGTATTCACATTCCCTTGCTGCCAGCCGTGCATCTTCCAACATCTAAACGCAGACGAGAAGCTGCTATCCCAGCTGCAGACGGCTTT
CTCGCCAAGACACGGTCAGAGTGCAGAGAGCGTCGTCTATGGAATCGACGACGCCAGCGGCTCCTGCCAGCGGCTTCGAGTACCGTTGGTCTGTCGACAG
TGTAAAATAGCTCAAAATCTCGGATTTGCGCTCGTGTTCTGCATCGTGACAGTGTTCTCAGAGTGTTCTCAGACATCATCATGATCGATGTGGACTTGGT
AGCGTCAGCCAACGAGCTTGCTAACGAGAGGAGTATCGCCGAGGCTCGTTGCCTTCAAGTTCGATGACGCCTGTCGTCATCATCCGATCGACTTTGCGCA
AGATCACAAAATTCGAATCCACCACCAGCTGTGGACCAATCACCGTGCGGTACACTGCGCCGCAACGCCAATCAGCATTTCGCCATGTTGCCGGTCGATG
GCTACGTGGCCGCCGTCGTCGCCGCCGCCTTGCTCGGGACGTACCTTGTCATGCACGTCTTCACGTGCAACCGCAGCAAGGTCGAGCTGCACTACCGCAC
CGACTCGCGTCTGCAGCAGTTTATCGCGGCCGTACGTCGACGCTAAACGACCCTCTCTGACGCGTTTTTTAGAACGCGCCGTCGGTCTCGGCGCCGTACC
ACCCGCCGTGGTGGGCCATCAACGCGCACATCCAGATCGCGATGACGCTGCTTGTGCCGCAGGCGCCGATCGCGTACACGCGCGAGCTGCTGCCGATGGC
CGACGGCGGCCAGATCGGCCTCGACTGGTGCGCCGGCGCCGAGACGCTGCCGGCGCATGCACCCGTCGTGCTCGTCGTCCATGGGCTCACCGGCTGCAGC
TACGACATGCGCTCGTTCTGCGCCGACGCGCTCCGCGCCGGCTTCCGCCCCGTCGCCTTCAACAAGCGCGGCCACGGCGACACGCCTTTGACGAGCCCCA
AGCTGCAGGCGTTTGGCTGCACGCAGGACCTCTCGGCCGCCATCGCACACATCCAGGCATCGTATCCTACGGCCAAGATTACAGGTACATGCAGGTCATG
ACGCTATCGTCTGGAAGAATCGCTTTCGTTAGGGGTTGGCTTCTCGGCCGGGTCGGGGCTCGTCACGTCCTACTTGGGCGAGACAGGCGCCAAGTCGCAG
CTCGCCGCCGCCGCCCTCGTCTCGCCTGGTACACCTCTCGGTGCTGTTGCTCTCGGCTCATCGAGATATATGGATGACGCAGGCTATGACGCCCTGGGAC
TCTTTTGCCACGGCGGCATTTACCCGCTCTACCATTTCCTCATGACGTTTACGCTGAAAGTATTGTCACCCTTACGAGAGAAGGGATTATGACGACTCGG
TGGGGATAGGGCTTGCTCAAGCGCCACAAAGACGTCTTGTCGTCGACGATCGATGTCGACGCGGCGCTGCAAGCGAGTTCGATTCCCGAGTTTGACCGCC
ACGTGTACATGACCATGCACGGCTACGACGACCTCGAAGCGTACTGGGCCAAGAACAATCCGATGCGCCAAGTCGAAAACATTGCAGTCCCGACGCTCTG
CATCAACGCGCGGGACGACCCTGTGTGCACCTACCGTACGCGCCGCTGCTACTTCATTGCACGTCGTACAATACTGTCTTGGACTAGGGATGATTCCTTT
TCAGGGTGTCTTTGATTCGAACCCAAATGCAATGCTGGCGCTGACAGCGTACGGCAGTCACTGCGGCTTTTCGAGCTCGACGGCCTCGAAATCAAGTCGT
GGGCGACGCGCGCGTCGCTCGACTACCTCCAGGCGGCGCTGCGCTATGAGCCTTGATACAATCCGAACGCAAGCGGTTCGAGTGAATGTAGTACTTAACA
TGTATTCAAGCGACAGAACGGGGCCTTGAGAGTAAATGGCACTTAAAAGGACGAATCGATCGCGCCGTTGGCGTAGAACTGGACCTTGTAGAGCCGCTTC
TCGTCGTCGGTCAAAAGCGGGTCGTCTTGGTGCAATGTCGGTGTGCTTGGCGGGCGGAACAAGCAGCTGCAAAAGAGCTGCCAGAACGGCCGGGACGCCA
TGCTTTTGCTCAACGTTTTGTCGTTGGGAAAGTGCTGCGCGAGTTTGTTCTTGGACGTCCGGCGCATCGGCGAGTCTTCGGGCGCAAATCCACCGTTCGT
ATCCACGTACTCGACGTACAGCGTCGCGCCGTCACTGTCGTCATTGTCCGACGACCCGTCGTCCTCCTCCTCTTGGAATTTCTTGAGCAAGTCGTCGGTG
AGCGCCATCTCCGCCGACGCGTGGGCTTGGGCCGCGCCAATCGTCGCGACGGCGGCTTTCATCGCCTCGGCCTTCTTCTGCGCCGACTCTTTCGATGCTT
GGAGACCTCGGGTCAGGCTGGCTTCTTTCTCGAGCTCGGCCGCAATGTGCTCGACCCAAAGGTGCTGCTCGGCACCTACTCCGTACGTGCTATTACAACA
ATGTTTGAATGCGGCCAAGACCCTACTGTTGTGGGCTTCGCAAAGCACGCTCTTGTGGCCTTGGACGTCCAAGACAAAGGTATGTTCGGGCACCGTCTAC
TCGGAGCTTTGTTGGCTGTTCAACTCATGACATAGACCACCGTACCGAGTTGAAGTCGATGTACGTCGTGGTGTCGGCGGCCATGGGCTTGGCGCCGAGC
ACTTTGAGCACACCGAGCGGCTGCGCTTGAGCGAGTGCGTCTTCTTGCGAGTTAAAGTAGAGCCACTCGGTGCTGAGCAAGACGCAGTACCTAAACAAGA
CACGTATATATCGACATGTGTTTTGACTTATGGAACAAAACCGCTTCTTCGCCACGCGGAGACCATGGCCTTTCTTGATGAGGTAGCCTTCCATGGACGC
GCCGGGATAGCTGCTCAGAGC