Description :
From Genome Similarity Track
Location :
contig_8:55846- 59075
Transcript NameFunction/comments
g1798.t1hypothetical protein

Sequence
3229 bases(100 bases per row)
CTGGTCTCATATACTCCGGAAAAATATTGCAACTCCATTGCTAGAGTGCACAATGGAGTGACATAATAGGCTTCTTGATGCACAGGACCAGAATGCTGTG
CTCAAATCGGCCTACGGGGTCAACTGCGATTTCGATTGCTTCAATCTCTAAAATCAAACAACCGCTTGATAATAAAAAACGTAATTTAAATTCCTTTCTT
TCCGAACAGCAGTTACAGGGTTATATACGGTCATGATTGTAGCGGATCCTGGTACGGACTAATATCAGCATACAGACAACGACGAAAAAATCCGACCGAC
ATAAAAATCTGGCATTTGACACTGGCACCACGCTCCCTCCATATTAAATCAATCCTGATTTCAACCAATCCGATCGCATTTTAGAATTGTTTTAGCCAAT
AGGTTACCAAATAAAATGAATGGCTCGCAGATCAAACGCCCCAGGTGTGACGGGAGTCACACAGCATCTTGTGCTTGAGGAAGTGCTAGGAGTATACCAA
CTCCAAGTGAACGGCAATTCACTAGTTCCCGGTATTGGGGAACGGTTGGCATAAAAAACAACATAGATTGTAGACTGATATATTCATAGTTAGTTACCTA
GAAATCGTCTGCAATACAATTCCTAAGTCAACTATTGTTTCTCCTATATGTTGTATGTATGGGTGGCTGTGGGCGTGTCAGTGGTGTTGGGTACACCATG
TACCCAACTCGGAAGAGTGACGGGCACTCTTAATGTAATCCCGTTACACAAGGGCTGTTGCTAATTCTCCGACTCAGTCTACGCTATAAACCGCATCGAA
CGAAGCCACAGTATCAAGACAATGCGTGAGGCGTTACACTGCTGGAGTGCGTTGGTGTCAAGGCTGCCTCGCAGCAACTCAATTTCGTCCGTGGGACGAT
CTACGATTAGGAGAAGCAGAAAATGCAATTTTCATCTTCAGGGCACATGCTTCGTTGAGGACGTTGAAAGGTCAGGGGTGCAAGGACATTTTTCTGGCGT
CACTGACCTAGTGGCGTACATGAAGGACGTTCGCCGCGACGAAGCCGTAAGTTACGCTTTTAGTATGCTGTTGTTTTGTACTGTCACGAAGATTAGCCAA
TTCTAATTTTACGGATCCGTGCCTTTTATATTTAAAACGCATAGGTTTTATCTACGGCTGGAATGATCGAGTTCATGTGAGAAATTCGCCCAGGCTAGAT
GAAATCCTATTTTGACGGTAAGGACGAAGGTGAAGCTGCACTCGAGCGTATGGTTCAGCGCATCACCAATCGGTAATATTTGATGATAATTTATAATGCT
TTTTTTTAACTTAAAAACATTTATTGCTTTTTTCTGCTTGAAATAGCCACGGGTTCTCCTCTCAGAAGCCCCCAGCCGCCAAAACGTCGTACGTCTGACC
TAGAGGAAACGCGGGCAATGGTTGCCCTAGATTTTTCTGCCCAACATGAAGCCTTTGATAGAGATGGCGGTTTAATGTTAACGAAGCTGTGATAATGTTC
AACATGCCACCGATCAAGGCTTGGCTGCGATAGACCAGAATGATTCGACGCGCATTTTGGGTGCAAACAAGCACGCCGGTCGCATGACAGCAGAGCTGAC
TGTACGCGACGATGTTAAGCATTAATATTTGTGATATTATGGATTGTTTTATTAATATGTGTGCTGTTACCGATTTTTTTTTAATTAATTTTTAATTGGT
TCTATGATTATAGGAAAGAAAATGCCGATTCACTTCAGCATATGCGGTGATCTGGGTGGACAAATCGAGCAAAATGAACTCGAGGAGTATTTCGATGGAC
ACTTCTACGCTGTACAAGAGAATGCATGGATGGATAGCTCGGTATGGAAATACTATGTTGAAAACTGATAAAATTTAAAATAGACGCACCAGCTGTCCTT
CTTGTTGACAATTTCGAATGTCACGTATCGGAAGAAGGACAGCGGCTTGTGGCCGAAGAAGCCAACGCTACGGTGGTTCCATTACCCCCAAACAGCATCG
CTGTTTGTCAACCACTAGATGTGGGGGCAATGGCACCACTTAAAGCTATAATTATAAGCAGCAGGAATCTACGGACGGGAGGAATTGCTAAGGAAAAACG
CATCCGTGCTATCCAGTCTACCATTGCTGCTTGGGACACCTTAACAGAAGCGACAATAATTCGTAGCTTCCAAAAGGCTATTCGTAAGTATCCGGAGGTA
ACAGTTTGAAATACAGTCTTTTTCTGTTCATTCATCTGTTATTTGGATTTGATTTTACAAATCATTTTTTTTACTAATCAAATGCACTGTCGTATTTTTT
TTGTCGGGATTGGTGATTTCTGTGACGGGGGTCACACGCACCTTAGCCTTAGAGGAAGCGTTAACGCGCTAACCACAAACAGACGCCTGGTGTCTCTGTT
GTAACCTTGCCTTCCAGTCGTTTCCGGGTACCGAGTACCAAACGACTTGCGAACTTCCAGGTTAGAGTTAAACTGTCTGTATTAATCTCCCTTGTAAGGT
CCTAACTACTGTAAACTAGCTGCATACTGAACTCCTGTCTAAACTGATGATCTTCCAAATGGGTGGCCCCCATTTGATCCGCTACGGTAAGTCCGACTCC
GTATCTAGTGTGATGTACACCATCGTACTTAACGTGCTGCAGGGTGCCACACACCAACTCGTGTGGGGTACGTACTCGTACTTAAGGTGACCAGTGTGGA
CCACACCGAAGAACAATGGGTCTCCCCTATTACAAGTTCTTTTGCTCGGCAACGGTGTAGGCCAGCGTGGCCCATTACAATTTCTATTTTAGTATGGAAG
TTGGCTTTCAGTGGTGTCGGATTTCTCCGTCGTTGTCTGTACAGCACGTGAAACCTCGCAAGGTCGTAACTAACGACTAGACGATGCATGAGAGGATGAC
GACATCTCGAGTATTGTATACTGCATAGTAAGGAAGCATATAGGAAAGACGAAACTAACAAAATCCACTGTAGCTAGCGCAGTAGTGGATGCATTGAATA
TCAGAGTCCATTTCACCTTCAACCAAGCACCCGGATTCTCAACCTGCAAGCATTTAGGACCGGAAGACAAAACAATGGTTTTGGAACTGTGCAGAAGAAA
TTTCGTCGGTGAAATGCAGGTGGTATCAAAACTATATCTGCTGACTACACCTTTTCCCACCCAAGTCTCGAAAATTTCAAATCAAGCTGCAAAATGGGAT
TTTGGGTACTAGCGCAAAAAGTGCATTTT