Description :
From Genome Similarity Track
Location :
scaffold_114:55837- 56952
Transcript NameFunction/comments
Pl_109451hypothetical protein PHYSODRAFT_329950

Sequence
1115 bases(100 bases per row)
CCCACACCGAAGTTCTGGCTGGTCGTGGTGAACCGCTTCGCACTGTTGGGCTGGTAGTAGGGGGCCACCTTCTTCGAGTTGGTCAGGGCAGCCGACTCGC
GGTTTCCAGACAGACCACCGCACTTCACCAGCGTGTTCTCAACGCAGTTACGGCCCAGCGTCGACTTGCACTTCGACTGCGTCGAGGTGGAAGGCACGAT
GATGGCACCGACAGTCTCAGTGTCGTTCTTGTTCGGGATAGCAGTGGACTCGAAGTAGTTGCCCTCCAGCAGCACATTGCCGTTCTCGACGACGTCGTAT
GAGAAACCCGTGTTGCTGTACCAGTAGTTGTTGGCGGCGTGGATAACGGAGCTGCCACCAACCTTGGGCGAACGGCCCGATGTGTTGTGTACGTAGTTGT
TGACGAGGCTGACCTGTGTCTGTGTGCCCAGGAAGAGGAAGGTCCAGTAGTGGTTTCCGTCGCATGTGGCCGAGTACTGCGTCTGACCGTCGAACTCCGA
GTTACTGATGGTCATGCTCTTGACACTAGCAGATCCGGTGGCGACCATCTGACGGCCAAGGTTAGAGATCTTGATGTGGTCGAGCCACACACGCTCCATA
GGGGTCTTACCGCCGTTCAGGCCCTGGATGTAGATAGCGTCGCCACCCCAGATGAGGTGCGCGTTCAATTGCGTGAGGTGGATGTTCTGGATGATAACAT
TGTTGCCACGGATCCACAGGCCCTTGCCCTTGATCACACCGCTAGTACCGACGCCGCGGAGAGTCTTGTTATCCGTAACCACGAGCGGATTCTTCGTGGC
GGCGAGATCATACGTGACCTTGACGGAAGTACCCTCTACGCAGCCTCCCGTGTTGGCCATACCACCGCTTTGGAGAATGACGTCTTGACCCTTGTGGCCG
TTGTTCTTGGCAAGACAGTCACGGTTGCTCTTGGGACGACAACCGTTCTCGGTTCTCGTGCCTTCGGTGCCACGGAAGTCAAAGGTCTTGGTGAGGACGA
TAACACGCGGCTGTGAGTCCTGCAAGTAGTTCTTGAGCTCGGCGAGCGAGGAGGGGTACACGGGAGTTGCGTTGCCTCCACCGGTGGTGCCCGCAGCGAG
ACCCGGAGCCTTTCC