Description :
From Genome Similarity Track
Location :
contig_42:558320- 577736
Transcript NameFunction/comments
g7785.t1hypothetical protein
g7786.t1hypothetical protein PHYSODRAFT_329696

Sequence
19416 bases(100 bases per row)
TCATTTCGTGGTCCGCGTTTGCGTCACTCATCGACGCACTATCCATTGCTGCTTCCTTCTCCATAATGTTCCCCGATACGCCGTCGAGTTTGTCGCCACT
TGGCGCTTTGTAGTAGTGATGCATGAACTGCTGCATAGCTCGGCGCCCCTCTTTACGCGACTGTCTTGTGCTGGTGCGAGTCGGCGACCGTGATCTCGCC
TTCTCTTCTGTTGTGCACGTCTTCATCAATTTCTGCATAGTTTGGATTTCCTCCGTCCCTGTTGCCAATTCCCATTCGGCTGGCGGGTGCCTCTTTGGTG
AGGTGGATCGCAATTCACTGGTACATTGGCGGTCTTATTCTTTCCCCCGGTGAAGGCTCTGAAGAATTATCCCGCTCCTCGATGTTGTTTCCTTCCTCGC
GAGGGGTTCATCTGATGTCCCAACTTTCTTTACGTTGGATCCCAACCTGTTGCTGTTAGAATCCTCCTCTCTGTGGTCCTTCCCCGTGGCGATATACTCC
TTGTCGAGACTGCGGTCCTGTTCTTAGTTGTTTCTTCGTAGGTTCCCCCGTCCGCTTCATGCACCTCCTCCACCATCTCGATATCTCCAATATGTTGTTC
GTCAGTTGATGGTGAGTCAGCTTCTGGGTCAACTTGCGCGTTTTTGTATTTTAAGTATTTGTTACCAGTGTTGCCGTCATCCTCCTCCGCTATCTGTTTC
GCATCACTGTGCACTTTGTTTTTGTTATCATTTTGCGTGTTGTGAGCTGCTGCTTCCTCATTCTTAATGCTGTGTAATTGTTCCCATTCCCGCGGTAGCG
TTGGTCCCTCTGCTAGCACCGACGTAGGTTGGTGTTGGGCCTCCTTCCTTTGTCCCCGTGTGGGCACCTGCTGCTTCATATTCGTTAGATCTTGTTCCAC
TTTCCCGTCTAGTCCTTTAAGCATGCGCCTTAGCTGCTCCATCGTTGTCGGTAAAGCTCGTGGCTGGTACGTTCTGGAACTCTTTCCAGTTTTGGACGGC
TGCGCACCTATCACTCTGAATGTGTGTAGGCGAACGGTGTTCTCCATAGTTGCTTCCTCCACTTTGCAATATTTGGTCGGATGCTCCGGTGATCTGCATG
CTTTGCACGGCCAGTTTACATGAACGTCCTGATGATGCAACCATCTCTGCCTCTTCATGAATGATATAGCCCGTGTCTTTCAACTTCGGTGGGCACGCTT
TCGCACGTATCTTCACAATCCACTGCTTGTCATTTATTCCTGTGTCTCCAATTTCCGTGTGAGCCAAAGTTTGCACCTGCAAACCCATCTTTTTGCCTAA
CACCCATAACAGATCCTTGGATGTCATTGCCCCCTTCCTAAGCGAGACTGTGAAATTATAGTAGTCCAATTTCACAAGTTCAAAAGTCGTCCTAGCCTCC
ACTCTTTGGCTTTCATAGTCAACTAGTTGCAGCAACCTCATTGCTAGTGGTAATCTCCACCCGATCCACCTTTTCGCAGCATTCTTGCCCTTGAAGGTGA
CTGTGATAACTCTTGTGTCACTGTCGAGCTCAATTCTGGATAGTGCTGCTTTGAATTCATCAATTTCCTGTTGTTGCTTAGGCGGCGCCTCTGCTCCTAC
CGTGATCTGTGCTAACAGCGCTCCTCTTGATAAATTTCCCCCAAAACGCTGACCTGGCGCCAATTGCGCATACAGCGGATATTCCAGAGCAATGAACATG
TCCGTGAAAGTTGCTAGTTCCATTGGCGTCATAGACTGCACAAGAAAACGAGGTGGGAAAGGCACTTCCAGTTCCTGATTGAGAATCATCAACAGCGCCC
GATCTTCATCTTCTGTCCGTTCTCTGAGCTTCGTTATTTCTGCTACTGGTTTCATACACAATTTGAGTAGGCGCTGTTGCTCCTCCGTGAGGTCCGCTTC
TGTCGCCCTGCCTCCTTGTTGCGTTACTGCTCTTAGATAGTCCCCCGTCGATGGCGTTTGTTGTTGTCTCTTTGCCTCGTGCTTGTTGCTCGTGAACGTG
AAACAGTGGATGCGCTCCTCTATCTCCTCTTGGTCCAGCCCTTCCTTCACGACCCACTGCTTCAACAGAAGTTGCATTCTTCCGGCGTGCTCCTCGTTCC
CATTCTCCCAGAAGCTGATTATGCCCTTGTATTTAGCGCGCTGCTGCGACGTGATGTCATCCTGCCATTCTACTTCACTCTCCGCTGCTTGTCCTTGGCT
CTTGGATGATACCGCTTTCTCGTCTTCGTACTTTTGAAATCTTCGCGTTCTGGCCAATTCATTGAGTCGTTGCACCAGATGGAATACATATTCTGCCGGT
GCGTCGTTGAGTAGGTAGGACCGCAGCTGCTTGAAAACTACTTCTCCATCTCCCTGATCTGCTCCTCTCCAGTTGCGTCCATTGTTCTTCCGCTGTTTAT
CTGCTGAGTAATCGGACTGTCGTTTCCGCTGCGGCGACAGTTTTCTTGCGCTCTGCTTGGTCGGGACAGCTGTCTTCTTCTCCCTAGCCGCTGAGCTCTT
GTCAGCTTTTCCCACCGTAGTCCACTGGATCTCTGTGGCAGCTTTTTGCTTCTGCCGTGTCGACGCCGTTTTACCTTCGGCTTGTCCGCCATAATTGTTG
TCGACTTGCTTCAGTCCGCTTTTGACACCCATCGCATTATCCCCGATGCCCTGCGCTTCTAATCGCTTGCCTGAGCCGTCTACCACGATCGACTCCATGC
TCCCCCGTTCCTTGGTCATGTCGTCTCCGTGCTTGCGTCCTTCCAGTTTTATCTGAAAGATTGTATACCGGGGGGTTACGCGTCCTTCCAAACGCCCCCC
GTAAGCTGTTCTCCGCCGATCTGATCCCGAGTCCGGAGAGTCTCGTTCGCCAGCCGGCAAGTTGGGAAGTGGTTTGTTCTTAATCTAGGCGGTCAACTCG
TTCGAGTAGAGAACACCTCACCCGCCTAAATCGAGACCAGCACCGACACCTCGTGTCGTCAATGCGAATGTCGGCCAGTGTCCTTTTAGTCATTGCTGGT
TTTCGCGACGTGATCTCGTCATTTGTCCTGCCCCATATGCGGCTGGAATGCCGAGTCGATCACTACTGGTCACGTAAAGTCTTGTTCGCTGCACGACGTA
TCCTTTCGCCTCCATGAAGCTAACAACGATGCCGCTTATCCTTGCTTGGAGGGATCATTCGCAGTTTTCACGCCTCGTTCACACGTCGCTCCAAGCCACA
AGTGCGATGGTTCTTCAGACAGCACTGCTCTTCGCTGGTGCATGCGTTGCGTGCTTGTTTGACTGCACCGCGGGGTTGACCAAGGGGCACGACCTCTCCT
CCGTGGGGCTCATGGAAACTGAGCAAGGCGCCAACTGGATCTCCACCTCGGGTAACACTACCACGATCGAGTCCATCCTAAGCGGAGGAGGCATGGACAC
CGTTCGGCTTCGGTATTTATTCACCTGAAAACTACTTCGGTAAGTACCAGCTACTAATCCTGTGAATGGTTCTGTACAGCATCTGGACGGACGGCGAGTA
CGATCTGGACTACACGTTGGCGCTGGCCCAGCGATTCTCCAAGGCCGGGTACAAGATCTACTTGGACATGCACTTCTCCGACACCTGGGCCGACCCAACC
GACCAAGCCATCCCTTCGTCATGGGACGACAGCTCGGTCACAACTCTTGCCGCTGATCTGCAGGCCTACGTGACGTCGACACTGAAGTCCTTCACGGACG
GCGGAGTCGACCTCGACATCTTGTCGTTGGGCAACGAAATCACCGACGGATTCCTCTTCCCGACCGGTCAAATCAACAATGACGACTTCAGTGCTTTGCT
ACGCTGTGGAAGGCTGCACGGCAGGGCGTGACAGACGCTGTATCGGCCGGCACGACCCAGCCCAAGGTGATGATCCACCTCGATAATGGCTGGAAGTACG
AGACCGTGTCGTGGTTCTTCGACGGTCTTTTCGCGGAGGGCACCGTGACTACCGACGACGTGGACGTGTTTGGCTTCTCATTCTACCCGTACTACAGCAC
GGACGCTACCATCGACGCCCTCACGTCTTCTCTGACTCAGTTGGCCAATTCGTACAGCAAGCCGATCTACGTGGCCGAGACGGACTGGCCGACGGAGTGC
TCGAGCGTCACACTGAGTGGTGACTACCCAGTGAGCGCCAAGGGCCAACGCGAGTGGGTGATCGCCATCATGGACGTCCTCGAGAGCTTGCCCAGCAGTT
TGGGCGCTGGTATTTTCTACTGGGAACCAGCATATCTGACGGTGGCAGGTCTCGGAAGTTCTTGCGAATCGGCGCTGCTTTTTAGCGTCAATTGGGACAA
CTGGCCGGAGACGTACGCGACTGCGCTTTCGTCGATCAACATGTTCTCGTGAGCCTAGGAAAGATTGATGCAGATGTATGTCGAGAAGGTGTCCATTATC
ACCTTGTTGCGTACAGTTCAGCGGGAAATGTAAAGTCTCCGTTTGTTTAGTCTCCGAATGCACGTGTCAGTGTCAAGGATTGCCTTGGCACCAGCTGCAC
AAGCAGCAAGAGATCACGCTAGGATGGGGGCTCGCTGTTGGGAGAATAATCTCTTCAACATGTTGAAGGATCTGTCCTTGTAGAAGCACCTATCTCGTTG
TTCGTTCCTAAATCAACTTTTTGGTCGCCGGACTGCACTGGACCTGCTCGTCATTCTCCAATTCCTACCCCAGGCAATCAGTTCGAGTAGACAAGTAGTG
GGAACATGGTCGTCGGAAGGACGCTGCTTTGGGTTGGTGTGTGTGCGACAGCTCTGCTCAATGGAGTGCAAGCGTTGACCAAGGGCCATGATCTATCGTC
TGCTGCCGTCATGGAGAAGGAGCAAGGCACTGTTTGGTACACTACCGCGGGCAAGGAGGCAGCAATCGAAGAGATTCTTGGCGCTGGAGGCATGGACAGC
GTGCGACTTCGGTGCGTACTAGTCCAGCTACACTATCTCAATATATTCACCTTACTGAAGGAGCTTGGTACTAACTAACAAATTGATACTTTACAGACTT
TGGACAGGAAAAGAATACGGCTTGGACTACACCCTAGCACAAGCTCAGCGATTCTCCAAAGCGGGATTCAAGATTTTCCTAGACTTGCACTTCTCCGACA
CCTGGGCGCAGCCGAGTGACCAGCAGACGCCGTCGGCTTGGGACGCTTCGTCCGTGGAGACGTTGGCGGCGGCATGTCGCGACCACGTCAGCTCCACGCT
GAAGGCGTTCACCGATGGCGGAGTGGGCTGGACCTCTTGTCTATCGGCAACGAGATCACCGACGGATTTCTCTACCCGACTGGTAAGATCAGCAACGACG
ATTTCGGACCTTTTGCCAAGTTGTGGAAGGCGGCACGGGAAGGCGTTGCGGATGCCGTGACGGCTGGAAGTACACAGCCGAAAGTGATGATTCACATCGA
CAACGGCTGGAAGTACGAGACGGTGTCGTGGTTCTTCAAGGTCTGTTTGATGAAGGAACGGTGACCACCGACGACGTGGACGCATTTGGGTTCTCGTTCT
ACCCGTACTACAACACGGAGGCGACGCTGGACGCTCTCACATCGTCACTTACTCAAATGGCAAACACGTACAAGAAACCGATTTACGTGGCGGAGACGGA
CTGGCCTACGAACTGCACGAAGGTGACTCTGAGTGAGAAGTACCCAGTTAGTGCACGGGTCAGCGCGAGTGGGTGACAGCTATTGTGAATGTGTTGGAAG
GTTTGCCGACGCGCTTGGTGCTGGTATTTTCTACTGGGAGCCGGGCTACATCAAGGTGCCGGGTCTGGGCAGCTCGTGCGAGTCAAACCTTCTTTTCGAT
GTGAACTGGGATAATTGGCCGGAGACGTACGCGACGGCACTTACGTCGGTGGACATGTTTAACTGAGGGTTTGCCTAATCTTCTCTTTGAAGTTATGCAC
ATTTTTGCTTACAGATCTAGTGCTGTTAAAACTTGAGTAAATTTCCTAAATGTTTATGGTTTCATGCCGGAAACCATAGGGTAAAAAACAAATGGCCTTT
TTTTTTTTAATGAACCAAACGCTACTATTATTATCAGTATCTCTTGCTTCTGAACATGGAAAATGCAGTTGTGAGTTTACTTTTGATTAGGCTTTTGACA
AAGTGATTCCTGTTAGTCAAAAAGCGCGCAGTATCTCGATGGTAAGGCAAATGTATATGTTAATACACTCAGTGTTACATGAGCACATTTTAATTGCTAT
ATGAACTCGCTTGTTTTCGGAGATATTTGACATAATCCCGAGCTGTTAGTACAGAGCTCAAAAAAGAAAACTACAATATAATAACGATAGTGTTAGAAAT
TATCGCATAAATTCAGTGTATGAATAAACAGAAAGCGGGCGCCATTAGACATTTTTGCTTACCTTTTACAACTTGATAGGCTCACAAATATGTCTGGGGT
ACCTCCTGTTGGACGAACGGGTCAACTAGCGACGTTGCTGTCAGAGTTGAACCGCCTGTCGATGAGGACCGTCTCTTTAGTTGTAGGAGTTTCCGAGGCT
GGCAGCAGGACCCTGCATTCTAACACTCAATTCATCCTACATCTTTCCTCACCACGAGAACTTCTCCAAGTTCCGACAGATCGCGCCTGCTGAACTGCCC
ACCACGCCTGCAACAACGAGCAACGCCCCCGCCCTCAACAAGGACGTTTTGCAAAACGAGGCACAGTCAAGAAATTAGAGATGTCAACTCCAAATTTTGG
CTGTGTCTGAAACGGCATATAACACGGTTGGATGCGCTGATCGCCAGAGAACAGCTCTGCTGGAGGAATAAATCCATTCTGAGATTCAATCCTATTTGTC
GCCGGGTAAGTAGATTGGTGTTACTACGTATAAGTAGATTGACGCTAAACCTACTTACTCAGACTTGACGACGCGAATCTGACTCGGAAAACATTAAGAG
AGTTGTCATAAGATTTAAAGATGGCATTATCGGCAAACAAGCACTCTAAGGAGATCCTTCATAAACAAACCAACGATGGCAACATCGCGCGTAAGCTGCC
CCCTGTGCTAGCATAACCTCGCCGCAACTAGCATACGGGCTCATATCGGCCAGCTGGCATGCGTGGAGCGTACTTGCCCAGAGCTGAGAGCTAGACCCCT
TGTGCTTGCCCAGCTAGCCAAGAAGGACTATGATCGTCGCTAAGCTCACGCCTGTCGCGACGGCATTCAGGATATGGGCGTCAGACTGCTCGAGTGGGCA
GCGGTCACCTCTGTCGAGGTTGATCAAGGCATCCCAATGCAAGAGACACCAAATGCCCACCATGTATTCGATACATTTGTCCCAGCTAGCCCTGTTCCAT
TTGCATCAAGAGAGGTGGAAATTATTGACATGACAGACGATGACAAGGTCGATGAAAGTACCTGCTCAATTTGCCAGTACGTATCGGTGGATCCGGTGCC
ACCGCGTTCGTCCTGTCATGCAATGTGCTCCGAGTGTGTGTTTGCTCTCGTCGTCCATTGTATTACAGAGGATGTTAACCCGCACTACCCCATTTGCCGC
GTCATTGTGCTTGTAAAGGCATTTGTTTAAACAATGTTGTATTTCAATATATGAAGCGGTTGGCCGGACCCCGGGTTCCCGCAACAGAAACCGAAAAAGG
CGGGAATTATTTATTTAATTTTGGACCTGCGGTCGCGGCGACCGAGTGCAAAACTACATCGTTTAGGAAACCAATAGCGCATTGGGGCCGTGTCGAGCAG
CAAGTCGACCGTGGACCCCGTGTGGAGAAGCAAGACGCCCTTGTTTCAAGAGCATCAAGCGAATATGACGCAACGGCGCGGAGGAGGGTTGCGGTCAACA
ATCCCGCAACGTAAACGGAAGAAGGGTTCTGACCGACAAGCTGCCGCATACCTTCGAGCAGTAGAGCTCCTGGGTGCTGACACCGTGAAGCAGATAAGAC
AGGATTGGGAATCTTGGGACACAAACTTCGGTGGCAGGGAGTGGCAACAATCTGAAGGCGTGGTGCTGCAGTTGATACAACAGGGACTATCCGAGCGCGT
GATCCGATCCATTATTCCAGTCGGTGGGAGCCGTATTTCGAGGCTGAGAAAGGTCCTTAAGGATGGAATTGACACCTTACACACAAGAAGATTGCCAATC
AAGCCATGGCACGCATTTAGTGAGCTGGACCTGGATGCTTTTAAGACTTACTGCGCATCTTGGACACTCGAGGATGGTTTTCCCTGCGCCCACCGCCGCC
CACGTCAGTACTTCACAGAGCCGAAACTGACGTGGGTTGTCGTGCATTCTCGGTATGTGGATGATATCTTGCGCGCCCATCCCGACGCCAGAACGCTAAG
CTATTCACGCTTCACTCAGTATGTGCACTTTTACTACCCTGGCGTCCGCTTAACACGAACTGCAGAAGACGTGTGTGATTGTTGTATTCGAAATTGACCA
AGGTGTCTGCACGGCGCGCAAAACGGTAAGTACGCCAGATGACCAATCGATCATATTCTCGATGATACCGCACAGCAACATCGAGTCTGTCCGCAAAGCA
GTGTTGGCTGAGCTTTTTGGAGCAAACATCAAAAGTGTTTGGGAAGCATCCGTTCGCGGCGTCCAGCTCCCTCGCCATCCAACCAAAGAACTATCCGCAA
AGAAAATCAAGTCATTGTCAGCTAAGTATTTCTCAATACCACAAGAGCACCTCGGCTACTATCCTGCCGTGCCTGAAGCGATCCTAAACGCCCCAGAGAT
CAATACCGAGCACACCGAAACAGGAGACCCCAACACTGATGCCACCGCGGGAAAACACAAGTCTGGTCGACCTCACAAGAAGAAAGTGAAGCTGCGAGCT
AAACAGCCTTCCATTCTGCAGTTCTTCAGCTCTGCTGCGAAGTAGAAAGATAAAGTAGTTTGACCTTTTTTTAAAAGAAAAAAATACCATTGCATTTTAC
CAAATACCGGTTGTTTTGCCAGAACCGGGGTCCTTGTGGGACCCCGGGTGCCCGCCAAACGCTTCATATATACTATAAACTGACGGGATAGAAACCATAT
CATTGAATACAGAAACAGCAAATCACGTCATCAGCTTTTCAAACTTATTGTACTCGTACGACTGACCTTGTACAATTTTACACTGAAATCGATGTGTAAT
CGTGGCCTAAACTTGTATGATTTTACACAAAATCCGAAAGATATAATTATCATAAACATACAATTGCACTTGCATCATTTAATAATATAACCTAGAGGGT
TGGTTAGAAAAAATGTATAATGTATAAACGTACCGAATTTCCCAACCAGTTGGCTGTCTCAGACAAATTGAATGCCACTTCGTCGTATAATGGTTGATTG
TACATTTCGTCAAACGCGTACGTAACGCAGTGTGCTTTATCGATTCCGTTCAAGTACTCAGTAGCTAGTGGACGTGTGTCAGATAGTTTAGAGTTGTAGA
ACTTGTAGTTTTCACATTCACTCCGCACCATCTGAAACACGAACGCCTGCTCCGGAGGCGACAAGGTTGACCCCTTCTTCTCAGCGATCGCTATGATGTT
TTGGTCACAGAATCGATGGCTAGATTCCAGGTACAGCTGACTCACAGATGAGATAAATCCGTTTTGGTGATCAGAAACAAAGATGAGTTTCCATCCATGA
CCAGCGGCCTCCACCGCATATTTCATGTGCGACAGGAACCAACTCCAATTCATATAGTCTTCTTGCTCCACCAGAGCAAGACCAAATACAAGAATATGGC
TGGCGAGGGGGTTTTGTAGTCACGAGAAGAAACACACCACACTTGTTTATGTCACCCTTTAAATAGGTCAAGGATATGTTTGTAATATTGCATCGCCTGC
AAACAAGCACCAGGAAAGAAACAGGCTATTGAAACCGCCATGGTCGTGCTTCTCCAAACCAAAATTCGATTTGGCGTTAGCCTCCGTAACCATGAGCAGA
TACGCTTCCAATATCTGGTAGCTCTCGGTGATATCCTCGCGTAAAGATCCAAGAAGATCTCGTTTCAACTTCGACACCATCGGGCGGTTTGTAGTGATTC
GTTGGATTTTTAGAAAATCCAAAATGGCGTTACCTGCGACTGTAGCCCAGGTATTGCTGTAAGCAGGAAGTATTTCTCGCTTTAGGATGCCGCGTCGTCC
CGTATGGCACATGGCGCTGACATTGCTGTTGCGTATCAGCTCTTCAACAAACGTGTCTTTTTGAAAACCAGCATGCATGCGCCAGATTCATCTACGTGAC
CTACCACTGATTGCGTAACCCATACCGCGATTAAGATTGGACATTGCTCGACACTCCCTAGAATCAGCGGCTGTTACCCTCCAGGCGCTTGCACGCGTAG
TTCGCGTTTCCTTCCCGGGTGGCCTTTAACCAGCTATTGTTCATCACACGAAGGGAAAAGCCCTGTCGACGAGCATACTCCCGACAACGAAGTTGTACAT
CCTTTCTTGATCAAATTAGCACTTTTACCAAAACAAGTGAACAGTGTGACAAATGTGTTAATAATGAGAACGAAGTTTTTCGTTAAAATGCTTTTCCCAC
AAAGTGAAATTTCATGCATTCGTGATTCTAACCAAGTGAACATCTAGCACCAACCATTGTATTTGAGCCGCAAGGCACAACCGCTCTCAGTTCCAATCCG
CCATACCTTCCTCCGACAAACTACCAGCAAACGCCAACATGAACGTGCGTGGAACTAAGGCCCGCATAGTGTGTGCGCACAAGGACGGCGAGAATTGGCG
CGCCGTCGCCGCTCACAATGGCATCCCCTATATCACGGCTCGGTGTGCGGTTCTCGGCGAAGACGCCGATCCCAAAAGATACACGGCGGCGTGCGAACGG
CGCGTGTCAAAATGTCCGTCGAGGTCATGAGCAAACTGGAGGAGTATCTCGACGAAGACAGCCGGCACACCTGCGAGCAGATGGGTGACAAGTTGTGTAG
CGACATGGACGTGTCCGTGAGCATATTCTCCGCTCACCATGCTCTTCGGGATATGGTCTACAGCCTTAAAAGCTGCGCATTAAGAAGATTTCAATGAACA
AGACGGAGAATAAGATCAAGATGATGGCTTTTGTGGAGAAGTTGAAGAAGTACAGACCTCTTCACTGCGGTATTGGCGACAGAGGAGTACTGTATACAGG
CACCGATGAACAAGATTGTCGTCGTGACCAACAATGCGTCACATCACGGTGAGGTGAAGACGTTGGCGAGGGAGATGCTTGTGGTGGACGGCATCATGAA
CAGCAACAAGCTGGTCGTGCTACGCCTCGCCCCGTACAGCCCCATGCTTATCCCAATTGAGGGCAGCTGCAACGTGTTCAAGGCGAAGATGCACCGTTAC
ATTGCTGAACAGAAAGAAGGGTTTCTAGTGAGGGGTGAGTACAGCACGTTTTCCGCGCATTGTTAGGCTCTCATAAAGGAGGCTGCTGAAGTAGCCAAGT
TTATAATTACTCGTCGTCTGGTTTGTCACATGGAGCGCCATTGTCTTAAGGCGTCGTTTGCCGCCGGCAGAGGCGAGGACATGGAGCTGGGCAAGTAGCT
GGGTGTACCCCTATTCACTTGGGTGAGAGCTCGACTACAGTAGCTCGATTTTCAAGTTGTTAAAAATAGCTTTTTCTATTCTAATTATTTTGTGCAAAAA
ATTGGATGCTCACTTGCTTTGGTAAAAGTGCCAACTCAGTTATCAAATGGTGTGGTGCTGACCGTGTCTCAAACATTATGTCCGCCAAGTTCCTTCCGTG
GTCTGTGACTTGGCCATATATGAAAGAGTGTGTACGATTCATCTGGAAATCGACATCACTGTGAAGGAGACCCATTCCTCGGAGATCTTCGATGCTCGCA
GTCTCGACGTGGCTAGTAGAAGTAACTAGAATCGTTATATTGTCTCACGCTGGTACGAAGGTTGGACATGGTAGGTGGAGGGACAGCGGAGAGTTCTGTC
GAATAGCAGAATGAGGCAAGGAATGTGACAGCAACGTGTGTGGTGGGCTCACGGTTGCGCAACAAGTGGATTCTTCTAGGTAGTGTTTTCGTAGCAGCAG
CAAAAAACACAGGAGTCTTGACACCTCTGCCAAAGAGTCGTTTAATGCGATGCTTTAGTAGGGCATAATATATGTAGGTACCAATTGAAAACGGACAAAC
TTTAAAAGTGTACGAGTCGAACGATCTCGCAAATTTTAATTTATTTTATGAGTCGCACGATTCTACAAAAGATAATTTTAATCGAGTCGTAAAAAGTCGT
AAATTTGAATTAATAATTAGGAAAATTAAGGATAAATAAGGTTTGGCTTCAATCTACTGATAAGCAGTATTAATAACACCAATCTACTTACCCGGCGACA
AGTAGGGCTGAATCTCATTGAATAGATTAGTTCCTCGCTCTGCTGTGACGTCAACACAGAGATCAAAGGCACCCTAGCTCGAGAGTTACTATCCGATGCC
ATAGATCTCGGGAAGCTCCTCGATCTCCAGAGTTAACTTGCCTTGCTTTTAATTAACGCAATCAGCCGTGTTGGCAGCCGGCTGTTCACTTCGCGGTTTC
GGTTGGTAATGGCAGTCTCCATTGGCAGCCTTGTGGTGCTACCACTGGTGGTGATGGCCACAAGGGCTAATTCCGTCATGTCCTCTGGGTAAAATCTTTC
CTCGGCATGAGAAAATAGACGAATGTGAGGCCTTCATGTTTCCTTCAAATGACATTGGCGCTTGACCATGGTATTTGGCGCCCAGATTTAGGGCCGCTTT
TTTGCAATTCAGAGACCCCGTAATCTTGATTTCAGTATGGTCTGCCCTATTCACTGAGTACGGTTCACCAGATTTTGAGATGGTGAAAAGTGTCAAGTCT
CCTCTGCAGCCTGGAGGACATGTGTGCGCGCACCGAAGGTGAAATGGTTCTACGCTACGTGTAAGCTTATCCAGTTTAGGTTGGGTGCAATCAATTAGAT
CACATCTGCAGGGGAAACAGGAGCCTAGTGGCGAGTGATATAATACTTTCGCCGTGCTTATTTGGCACTTCGCTGCTCGTTTTCTTAATCTCCGCCCTCT
GGTCGACGACTAGTGGTCGTACATTCGCCTCTGGTGCACCGGATCTGCTCGCTTATGTCACGCTTCTCCATCCTTGACAACCACTTCGATTTGTCAAGTG
AACGGAGGAGGGAACTATGCTCGCTCGGAGAACGCTGCTGTGGTTGGGAGCTTTTGCGGCACCTCTGCTCAATGGAGTGCAAGCGTTGACCAAGGGTCAT
GATCTATCGTCTGCTGCCGTCATGGAGAAGGAGCAAGGCACTGTTTGGTACTCCACAAAGGGCAAGGAGATGGCAATCGAAGAGATTCTTGGCGCTGGAG
GCATGGACAGCGTGCGACTTCGGTGCGTACTAGTCCAGCTACACTATCTCAATATATTCACCTTACTGAAGGAGCTTGGTACTAACTAACAAATTGATAC
TTTACAGACTTTGGACAGGAAAAGAGTACGGCTTGGACTACACCCTAGCACAAGCTCAGCGATTCTCCAAAGCGGGATTCAAGATTTTCCTAGACTTGCA
CTTCTCCGACACCTGGGCGCAGCCGAGTGACCAGCAGACGCCGTCGGCTTGGGACGCTTCGTCCGTGGAGACGTTGGCGGCGGCATGTCGCGACCACGTC
AGCTCCACGCTGAAGGCGTTCACCGATGGCGGAGTGGAGCTGGACCTCTTGTCTATCGGCAACGAGATCACCGACGGATTTCTCTACCCGACTGGTAAGA
TCAGCAACGACGATTTCGGACCTTTTGCCAAGCTGTGGAAGGCGGCACGGGAAGGCGTTGCGGATGCCGTGACGGCTGGAAGTACACAGCCGAAAGTGAT
GATTCACATCGACAACGGCTGGAAGTACGAGACGGTGTCGTGGTTCTTCAAGGGTCTGTTTGATGAAGGAACGGTGACCACCGACGACGTGGACGCATTT
GGGTTCTCGTTCTACCCGTACTACAACACGGAGGCGACGCTGGACGCTCTCACATCGTCACTTACTCAAATGGCAAACACGTACAAGAAACCGATTTACG
TGGCGGAGACGGACTGGCCTACGAACTGCACGAAGGTGACTCTGAGTGAGAAGTACCCAGTTAGTGCACGGGGTCAGCGCGAGTGGGTGATGGCTATCAT
AGACGTTCTCGAAGGTTTGCCGAACGCACTTGGTGCTGGTATTTTCTACTGGGAGCCGGGCTACATCAAGGTGCCGGGTCTGGGCAGCTCGTGCGAGTCA
AACCTTCTTTTCCACGTGAACTGGGACAATTGGCCGGAGACGTACGCGAATGCACTTTCATCCGTTTACATGTTTGGCGACAAGGGCTCTTCCCAAGGCA
ACAGCTCTGCTCAACAGACCAGCCCCACTCAAGAAACCCAGACCGATCCTTCGCAGCAAATGCAATCCAGCTCCTCGCAGCAGATGCGATCCAGCTCTTC
AGAACAGGAAAACGAAGATACTGAGCAGCAAACGGCAGCTTCGGAAAGTACCACGCAGCAACAGTAGCCATCAGAAAATATCCTGAAAATATCAACAGCT
CCCATCGAGCAAAGCTTTGATTGAAAACTTGAACCACGAGACAGAGCGAAATACAGTGAAGCAAGCCCGCTTTCAAATACATGTAGTAAACAATGGAGGT
GCCGCCCAGCTTTCATCCTCGTGCAACCACAGCCTTCGGGCACTCCGGGGCTCGTCTGCAGTGCGTTCGGCTTTGGCACGGCGTAGAGCGTGGAAGAGTG
CTACTGAAAGCGCTGACGAAACCAATGCGTGAACACTTGCAGTGACGAGTGCAAGGACCACATAGCTGCTTGATCTATGTTGTCGATATTTCGAGCTCAG
GAATTCACGTAGGAGGTCGATCGGAGACTTCTGTTAAGGTGGGGTGATACCTGGGAAGCACACACCCAAGGGGACATATGTCAGGTTAGTGACGCGTAAC
ACCGCACTAGACCTACTACAGCAAGAAACCCTTGAGGTGGGATACATGTACTCCACCAGTGAACTTCAACCGGAAGACCTCAGCCGAGACTTCAACGGAG
CAGCAATCTGGTTAAAGACGACACTGCCTGCAGGCTTGATGCACTGTTCGAATGAGTCAGCTACTACAGTCATACTTCAAGGATCAGACTGAGCAACTAC
ACTATGAGCTTACGTGGTATTTTTGCAGCTGAATGTAGGGATCCCTCCCTCCTCACAAACACCAGTGCACTAGTCGTGCACTCCATTCCAAGAGCTTTTC
GAGAAGCTCATTCCCGATTTTCAAGTCTGCTCCGCAAGTCCAACAGCAAAACAACCAAGGAGCCGAATGTTTTTCAAGTCGGCACTTCTCGTTGCCGGTG
CATGCGTTGCGAGCGTGTTCACCACCGCTGCAGCGCTGACCAAGGGCCACGACTTGTCTTCCGTTGCTTTGATGGAAACAACCCAAGGTGCCCAGTGGAT
CTCCACCTCTGGCAAGACAACCACGATCGAATCCATCCTCGGGGATGCAGGCATGGACTCTGTTCGACTCCGGTACGTCCACTTGTCAGCATTAACCTAC
ACCACTCACCTCTCTGACGGTATAACGCAGCATTTGGACGGACGGTGACTATGACCTGGACTACACGCTGGCGTTGGCCAAGCGCTTCTCCAAGGCAGGA
TACAAGATCTACCTGGACATGCACTTCTCCGACACGTGGGCAGATCCGCACAAGCAAGGCATCCCTGCAGCATGGGACAAAACGTCGGTCACGACGCTGG
CTGCTGCTCTGCGATCCTACATGAAGTCGACGTTGAAGTCCTTCACGGACGGCGGTGTCACCATCGACATCCTGTCGCTGGGCAATGAGATCACAGTCGG
ATTCCTCTGGCCGACGGGCAAGATCACCAACAGCAATTACGGTAACTTTGCTACGTTGTGGAAGGCTGCGCGTCAAGGAGTGACGGATGCTGTAGCGGCC
GGTACCAAGAAACCCAAGGTCATGATCCACATTGACAACGGATGGGACTACAGACAACGACACAAATACCCGGGCAACACAAAACCCGGGAACACGAGAA
ATACATTTATTTTTACCAATCAAATTACTAGAAAAATATATATATTTACCAATCATGATGAAAAAATAAAAATTGGATGGCCAGCAGCTAAAACGCCGAG
GCACCGGCCAGTCCTGCCACTGCAACAAATGCCGCGGAAGCAACATAGCTACACCATGAAGGTGAAGCTGGTGGCGCTGGATTCCATCGAGCGGATCGGC
TTGACCGCGACGGTCGCCGAGCTCCGGTACCCCCATGGGACCGTGGACGGGTGGTGGCGGGCGCGTGACAAGCTCCGAGCGTACGCTGGAAACAAGCTGT
CCAAGACGATAAATGGGCAGGGGCGCAAGGAAAGCTTTCTTTCACCCCAGCCCTCGTCACCTTCATGAAGGACACTCGCCGGGACGAAGAGGTACGTTTT
ATATCATTTTTACAATTTTTGCATTATTTCTAACGTTAAGCGTCTATGTAGTGGCTCACTACGTCGATAATGATAGGTTTTATAGCGGAGAACTATGAAG
AATGGCTAGAACAATACGAAGAAGGCAAAACGTCGCCTCAGAGCTGCCGAAAGGCGCTGGAGAGACTACTGCAGAGAACAGAAAATCGGTAAAAACTTTT
GTCTCAGTACATTGAACATTATATCTATACTAAATGTGTCATGTACTGTCATTATGTACTGTTTTTAGATATGGATTTTCGACACAAAAGGCTCAAGAAA
CGAAGTTGCCGTGCTTAGATCTGATGCAGATTAAGCAGGACTTTGCTATTGAGTTTTGGTCTGTCTACAGCTCCTACTAACCTTCTGAAATTCACAATAT
GAGTTTTCAGAGGAGCTAGTAATTTGTAGCTTTCAGACAGCAATTCCTAGGATCGAGTCAATGACAGTTTAAGCGATTAATAAAATGGTGTTTTTATATT
TTCTTTGAAGTTTGTATTTACCAATCAGAGCATTGGTCTGTGGCCTGTTTGGCCCGGGTATTTGTGTCGCTGTCTGTACGCCTACGTGTCCGCGTTCTTC
ACCGGGCTCTTCGCTACTGGTACGGTGACTACCAGCGACGTGGACGTGTTCGGCTTCTCGTTCTACCCGTTCTACGACTCGAAAGCTACGATCAGTTCAC
TCAAGTCTTCGCTGACTCAAATCGCCAACAAATACCAAAAGCCGATCTACGTCGCCGAGACGGACTGGCCGACGGAGTGCTCCACTGTCACGCTGAGCGC
TAGTTACCCAGTGAACGCCAAGGGCCAACGCCAGTGGGTAGCTGCTATCATCGACGTCCTGAACGGTTTGCCAAGCAGCTTGGGCGCCGGTATTTTCTAC
TGGGAGCCGGCGTACCTGACGGTGGCGGGTCTAGGCAGCTCTTGCCAATCGGCTCTACTCTTCAGCGTCAACTGGAATAACTGGCCGGTGACCTACGCGA
CGGCGCTCTCGTCTGTCTACATGTTCAGTTGACCAACCGGTTGACGGAGACCATAGCGTCTAGCCTGTTCTTTTGCAAAGTCGAAGAGTTTAGTTCTCTT
CGAAGCCCAACTAAGCTTGATGCCTGCTCGTGGCGTGTCGAACCACACTGTCTCCTTAGTGTTCCCTTTGAAACTGGGCAAATCGATCTCGAATTTGCCT
TTGCTGCTGATCGAGTAGGTTGGCGACGAATGTGGCGTCTCCACTTTGCCCCGGTTCACCCAGCCGCTCGAAGAAGATTGCACGCACCAGGTCGGTACTG
AGACGGAGATCGCGCTCGATGTCAGCGCGCAGGCAACGACCGTTTTCTTGAATTGCTTCTTTTGAAGTTGCTCCATGGGTCCGTACAAAGTGCTGCAGTC
TTGAAGATCTTCGTAACTTCGCTTTGTACCAGTCTGAACTCGACCTGAAACGCGGCCATGAGGCGCCTCCGTACGCAGTTTTGGCCTCGGTGTGACCTCT
GTCGAGACTTCTTCGGTACTCTCTTCACTCTCATCGGAGCTAGAGCAATCACCGAACAACGTCTGGTCAATCCTTTTCTTGGGTTTTCCATCTTCCATGT
CGGCTGGAACGCTGAAGATTTCGCCATTTTCTGGAGCTGGGGCTGGCAAAGTGCATCCAGAGGAATCTACGCGCTGCATTTCGTCGAAAATGTCGTGGCT
GATGTCTTCAAATTCTGCTGGGAGAGCGTACCAGTCTACACGCAAGCTTTGCTCGCTGTCTGAGAGCTGGAACCACGTTACGGGGGCGTGGCGCTCGTTG
AAAGCTCGGATGAAGAGATACGAGGCGGCAATGCGCTTCATTTTTCGCCAAGCGCTGAAGGTCGAGTGACTCCAGGGAGTGTATAGCGTCGCGGACTCGT
CGTAGCCCTGAGCCATGAAAGCGCTGACCAAAGTGTTTGACTTCTTCATCACATGACTCCAAGACTGTACGAGAGATTTTACTTCGCACGGAGACCAACA
CGAACTGCACTTTGACGGGTGCTGAGCTTCTGTTTTGGGCTTGGATGCAATCGCTTTCCGCACTTTTGCCCACTTGCGCACCGATTTCAGCTGGAGAAGC
GTCTTGTAGGACGCCCGTGTAAGGTTCCAGCAGGTTTTCCTGACTGACGTAGGCATCTCCACTCGGTTCCGTTCTTCTCTAGGCAGATCAAACCACAGGC
GACCACCGGCCACTTGCTGAATCTCGTTGAAGCGGTTTACAACTTGTACGACCTTGTAGAGCTTGCAGCGCTGGCATCCGATACTGTCAGAAGTGCGACT
TTTGTTGGTCCGCTGCGAGAGTTGTTCGGCAATGTGGCTGTTAATGCCGCCTCCACTCTTCGTCCGCGAATGCATATACGCTGTAGGGTTAGATTCCAGC
TCTCTCCACAGCTCAATCATTAGTGACACCTCTTTCTCGGTCCATTCCGGGTGGAGGAAGCTCGGGTCGCTTCGATCAAAGACCCCCGCGGACTTCATCC
TACTTGAGCAAGTGGTTTCCCCGCTTGAAAAAATAAAAACGAGAAAGGGAACGGCGTTGAACAACAACGTACGAGGTTCAATTCGAAAAGTATATTCCTA
ATGGAACGAAGATTGACTACACCTAGCACAGGTCCCCCTCTGCTGGTCCTCCGATCGGATCATTTTTTCTCGTGGTAACGCGGTCCAAGAAGCGCGCGGT
TCTCAGCTTCTTCACGGGTCCGTTTCTCCATAAACTGATCAAACCGATCGCGGATCTGCTGCTGCTGCATGTTCAGTACCTTGGTCACGAAAGCGACGTC
GCCGCTGCTCTCCGGGTCCTCAAACTGGTGGCTGATGATGGAGCGCAGCATCTCCGCGCTGCGTTGGATTTCGCTTTCAACGTCAGCACGCAACTTGCTC
GCGGCTCGACGCATTTTCTTGTTCTGCAGCTCCATCATGTTGTCGAGAAGAATATTGCAGTCGCGGTGCTTGCGTTTGGGCGGAAAGTCCAGCTCTGGCT
TGGGCTGCTCGGTTTC