Description :
From Genome Similarity Track
Location :
Scaffold_593:5581- 8490
Sequence
2909 bases(100 bases per row)
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNACCCATACAACCTTCAGATGCTGTGCGCGTAAGTTCCTTCCGATCTGATGCTACGCCGGACAGCCAGACTATTATGAAATAATT
TGCAAAGCGAGAATTGAGCCGGAAACGTGCAATGTTGAAGACTATTTCAGCATGTTACAGCGGACGCCCTGTGCTTCAAGCTCGTCATTACATATCCCGA
TACATCGCTTTGCTGGTGGCAACGAAGAATTCTCGTCCTCGACAACGTTTACTTACTTAGCTCAACACTATTCAGTGTGAGTGAGCGCGGAGTCTTGCTC
ACCACCGACTAAATGACGGGGAGGAGCTACGCATCTCGAGTTTTTGGGCTTAGATCTGGAGATCTGTATATTGTGGCTTGCAGGGATTTTGCCCTCTCAT
TTACAACTTTATATCGAACCCCGATTTATATAAATTGGAGCTGTAGGGGTCTGAAATAGGGATCGAACATTCAAAGCAGGTGAAATACATAGTGAAGTCA
AATAAAGCATGCTCTACACTGTTCAATGTCCATCTACTCTAACTAGTAGGTGCAGAGATAGCTTAGGTGACAGCGCAGCGAGCGGGTTGTTTACTTGTTC
GTTCTGCTTTCTTAGCTGAAAGAATCGACGCGGTGTATGTTGCCATGGCACTACTCTTCCGTAAAAGGCACGCTGCCGTGCATGCACCCCCGATTGTACA
TGTAGTGGATTTGCCACAGCTGACCTGAGATAATCACTGCCCCTCAGAATTGCAACATTAAAGCGGCAATTCGGGTAGCTGCTAACAAATCGGAATGGCG
ATCCCATCAAATCGGACCACTTTAACAATTCGGACCCGATATATCGGATATATGAGGCCCTGATTTGCCAAAATCGCTGCAAGCCACAATACAAGTACTA
TTGTGCTTTGCACGAACTTTGGCATGCGATTAAGGGCTCTAAACCAACGAGCAAATCCTTCCAGGTGATCATATCTCGCAGCCTAACTCGAAGTTAAAGT
TAAGCTAATCAACCGCAAGCACAACGCAGAGCAAGAACGGAGCGGTTGCCACTGCAAGAATAAATCGGTTGTCGCTGCAAGAAAACAAACTGATAAGGTC
CCCGATAGAATGGCGCCAACTCCTTGGATAATAGTAAGCACCGATTTCGGCGGGGACGTTTTCTTTCGCTCTCTTCGTCGTGGCCTTGCGCGTTAAACCA
AGCTCGAATTTCATAGCACGGCATATAGTAGCAGTAGAAAATTTCTACTAGAAATGTTTGGTAGTTCAGGAAACGCTGACTTAAAGCTGCTTGCAGCTCC
TCGATATAAAAACAGGGATGTTCTTCAATATTGTACACGTAGTTTAGTACGATAGATCGCCAACGCATGTCAATCATCGACTAGAAAGCAATCAGACAAA
GCGAGCGAG