Description :
From Genome Similarity Track
Location :
Scaffold_1175:5581- 7420
Transcript NameFunction/comments
g14768.t1hypothetical protein

Sequence
1839 bases(100 bases per row)
TCTTGCGTGGAGTACAAAGGAGGTGTTACTCCCGACGACATTCTGCCGGAGTTACCGCAGGAGAAAGGTGTTCAGCACGAGATTGATCTCGTGCCGGGAA
CGAAGTATTGCGTCACGCGGCAGTGGCCACTGCCGCGTGAGCAAGTCAAGGCAATCGACGCCTTCTTTGAAAGTCGTCGCAATGCAGGACAAGTGCGGGA
ATCGAAGTCCCAGCACAGCGCGCCTACGTTCTGTGTGAAGAAACCACAGGGCGGGTGGCGCATCGTTCATGCGTACAACAAGCTGAACGATGCGACGGTA
CCGGCACAGACGCCGATACCTCGAAAAGATGTGACCATCGATTCGATGACCTCGAGTACTATCTTCAGTACTCTTGATCTGAGAGACGGGTTCTATCAGA
TCCTCATGCGTGAGAGCGATATCCCTCTCACGGCGGTAAGCACTCCGAGCGGCATGCTCTGGGAGTGGCTCGTAATGCCGCAGGGGCTGAAGAACGCCCC
AGCGACGTTCAACAGGTGCGTCACGCACTTGTTGCGTTCGGTGCGCGACTTCGCACCGAGCTATTCCGACGACGTGTTCATTCACAGCCCGGCTGTGAAT
GGGAAATCGGATGTGGAGATGCATACAGAGCATCTCCGCAAGTTGCTTGAGCTCATGCGAAAGCACAAGCTCTACGCGAACCTGAAGAAGTGTATCTTCG
GGGCGACCGAGATACCCGTACTTGGGTGTCTCGTGGGGAAAAACGGCGTACGCCCTGACCCAGGAAAGGTCAGAGTGATCAATGAATGGCCTACGCCTTC
AAACGTAAAGGAACTGCGGCAGTTCCTTGGACTCGCCACGTACTTGTGCAAGTACGTGAGCAACTACGCGGGCAAGATTCGCCCGCTGTCGCAGCTCTTG
AAGAAAGAGGCTGCATGGGAATGGCCTGCTGATTGTCAGCAGGCCTTCGAAGCAGTCAAGCAGGGCTTGACTGAGGCGCCGATCTTGGCGGTGGCCGACC
AATATCGCCCATTCCACGTTGTGTGCGATGCATCCGATTTCGCGATCGGATGCGCACTGATGCAACTCGATCACGAAGGTCGTGATCGTGTGGTTTACTA
CCAATCGCGTCAGCTGAAGCCAGCTGAGCGCAATTACCTGGTACATGACAAGGAACTCCTTGCCATGAAGTATGCACTCGCAAAGTTTCGAGTGTATCTA
CTTGGGAGTAGACCATTCGTGGTCTACACCGACCACGCATCGTTGTGTACAGCGATCAAGTCGCCGCACATATCACAAAGAATGGCACGGTGGCTGTCAT
TCTTTGGTGAATACAACTTCCAGGTTGAGTACAAACCTGGAAGGTTGAATGTCGTGGCCGACGCGCTTTCGCGTCGACCAGATTATGCGGTGCAAGAGGC
CGACGCCAACGCAGTTGGCGTCGTCAGGACGACTACACCCTCGTCGTCCTCGCTGGACGAAGTGAAGGCCGCATACGCACATGATGCGGATGCGAAGCAA
TTGTTGGAGTACTACTCCACACCTTCTGACAAGTCTCGTCAGAAGCTGGCCAAACACCTTCGTGTCCGTGTACACCGTTATCGTGTACACAATGGTCTGC
TGCTTTACAGCGCAGTCGACGACAACGCAGATCGCATTGTCGTGCCGGATGATCATGAGTTGAAGCTCAAGATCACGTATGAGTACCACGATGCCCCGAC
ATCGGGACATCCTGGCCGTGAGAAGACATACTTGCTTCTCACGCGTGCCTTCTACTGGAGTCACCAGTACAAATGGGTACGCAAGTACGTTCGTGCTTGC
GAGGTATGCCAGCGCGTGAAGCCTGCGCCCAACTCGCAG