Description :
From Genome Similarity Track
Location :
Scaffold_177:55802- 58349
Transcript NameFunction/comments
Hyaar_Emoy2811952hypothetical protein

Sequence
2547 bases(100 bases per row)
GTGCCTTCAAATCCAATGGTGGGAGGTCCGCCCCGTCGAGAATTTGGTTACTAATGATAACCAGCGCTGGCACCATAAGAGCAGACGTATCCTTGTAGAA
ATCGTTGTTTAGACCATCCTGCCCGGCGGATTTATGCCGGCTAAGTCCTTGAACAGCTAAAAGCATCTCAGCTTCCGTAATCGGCCTTAGAAGCCGTTCG
TTGTCAAGGCGAGAGAGCCATTTATTCTCTGAAATGGTCACAAATTTGTGCATAGCGGCAGGCAAAGCGTCCAGAGACCGGTGACGGGAGCTTAAATTGG
TGCCCATTCGGACGCAAATTTTTCTGCCATTGTCATATGATCGGTAAAAGCGCTCCCATGATAAAACCGCAAAGCTGTGACATGTTGATTACTCTCCCAA
CTAGCCACGCGCTTGTAGGACAAGCGGAGACGCTCTGTCGACCGTTCAAGGCTCTCGCCAAGTCGAGTCATACGGTCCTCCCGCAGTTCTTCGATGTTGG
CAGAGATCCCCTGTCGCCGGGTAAGAAACTGCTGTCGGCTTCGGCGTCGCATTCGTCCAATACTCCGTCGCCGCCACTGCTTTTCCCGTTCTGTCACCAA
TCGGATGCAGTTTGTACATCGAGTAATGTGTGCATCCCACGTCTGAGCAGTCGGAGCGTGTTCCACACGCAGATTACCTAGTTCCATCATCAAATCATCA
AGAACGCGGTCCGACCGGCTAGTCCGTATGGAATGCTGCATGGTGTCGCCGAGTATGTTCCGGATCAAGTTGCTTTACCCGTAAATGCAGTTCTACCTGT
TGATGATCAGAATAGTCAGGAGGTGGTGTAGTTGAGAGCCATATAACATCCGGTGCCCAGTCAGTTGGTACGTAATAACGATCAATTCGACTAGCGTTCT
CCTTGGTCCAATACGTGAAGTGATCAATTGTAATCGACGTCTCATCATCTTCCGCATGCTCGCGCAGGAGTCAAGCATCACTCAGCCCGTGGCTGGTGAG
AAATCCGCCCAATGCTGGGCTCTCAGGCCGACTGGCAGATCGTGGCCCCATTCGGTCCAAATGAGGACTTGCACACTATTAAAATCTCCAAGAAGAACAG
AAGTACCCGAAGGTAAGTTCCAGTCATGAAGGCTGTCAAATAGTGACTCCCGCTCTGGCCGGTCATTTGGTGCATACACATTAAGAATATACATGTCATG
CACCGATATCCCGATAGCTCTCGTATTCCACCGGTCCTCATTCCAGGCAGCCGCGTGTAAAGCAGCCTGTGGCGTGAGTAGGATAGCAACCCCACTCGAC
CTAGAGGATCCGTAGCTCCAATAAGACATCGGTACCTGATCCGTGTCACAGTCTTGACCCCATATCCGGCGCCACTCTAGACGAAGCGTATTTGCTTCCT
CGACGGTCGCGACGTGAGTTTCTTGAATGCACCATGCAAGAGGCCGTTGTCTTACTGGTGTCTTGCGCCAGGCTGACATCCAGAGAAGCCTTGTAGATTT
GGAAAAGCCTCGAACATTTTGGCTGATAATCCGTCGATCAGCAGCAGAGAGACCCGCGTGAGTTGTTGTGGACAAGCGATGACCATTCAATAATGCGTAG
CGTCCATAACAATCAGAAGTTGATAGCTCCGACCCGTACAGGCTCGTCGCTACTGAAAATCGTGCGGTGCCTTTAGTACTGGATAAGATTCTTCTCCTCC
TGGTAGGCTAACCCGGAGTAGAAAAATCTGTCAATTGCACGTCAGTTGGTATGCTTGGAAGAGTCATAATACGCTGCCTTGTATCCAGTATTGGACAAGA
GAAGCTGAATATGCGAGCGCAGCTTGGCCGATGTCCCCGTACGCGTCGGTAAACCATCAGATAGAGCTGCGATTTCACGGTCGTAGACAAGTGCATAGAG
CAAGTGCTGACTCATGCTAGTACGCCGTTGTGGGTCACATAGACGAAGCACCCCGTCCCCTTGCTACTTAATAAGTTCCAGTCGTCCCTGTTGTCCATCA
GCGGTGCGAGCAACGATGTTGAACCACGATACTGAGTACGTTCAATCCACCCATCTAACCATGTTTGCATAGTGAGGTCTAGGGGCTGTTGTCGATATGC
CTGCAACCCTTCAGATAAACAATCGCGTCGCCGTTCGGTCATCCACTGCACCATGACAGACACATCTAAGGACTTCAATAACTCACCAGGCAACTCAAAA
CGCTTGACCAGCTGCAATAATTGCTCCGGTGCCTATCGAGCCACTCGCTGCCACTCACTGGTGGAGCTGAAAGCGGTGGGGAAAGGTATTTGGTCATGAT
GTTGCCAGGTGTCTCCTTGTAAGTCCCACGCGGCCTCCCAATCGTCGACATCAATCCGATCATATTCCTCATCAAACGTGATCTGTCTCGTGACAGGCAT
ACTGCGTCCTTTTTTCATGACTGCCTCATTGTGATTAGACCGTACGATAGTACCCTCCGTAACACAGATCTCAGGCGATGACACCTGTCCACGTTTTCGA
GCGACTTCGGACGAGTGTCGCGCCGTGGGAGGAGGTGTCGTAGGCAG