Description :
From Genome Similarity Track
Location :
Scaffold_1225:5580- 7661
Transcript NameFunction/comments
Pytar_ATCC12531snap-par_contig_1225-abinit-gene-0.8Reverse transcriptase

Sequence
2081 bases(100 bases per row)
GAATCGCCGATCACGATTACATCTCGCGCACCCTAGGTCGCGGAGATACTCGAGCCCTGTCAGCAGACCGGTATACTCAGCTTCATTCACAGTAACACCG
CTCAGGGACAGGCCGACGGCATGAACTGGCGTCCAACCCGGCATCTGCCACACGATGAAACTGGCGCTGCCCGACCGGTTCTTCAACTTCGCCGCACCGT
CGAACGTGAGCACTAGACCCGTGAACCCGTCATTCACGACCTCGATCCCGAGTGGGACAACATATTCTGCACGGCGGGCCTTGATCGGAACTAGTCGATC
AGCCAGTTCGTCAAGCTTATCACGCGGGGTAATACCGGCAGACAGGAGCTGAGCCAGTCCGTCCTCGTCCTTTCGGACCCGTCGAACTTCGAGAGACCAT
GGCGAAAGAAGTGTTGCCCATTGTAGACAACGACCACTGAGTGAGCGCCCGGTTAACAACCAGTTCAGCGTCAAGGTTCTCGTATAGACGACAATCTCGT
GGCCGGCCACCAGGGTGTAGAACGTAGTTAGCACCCGGAGCAGAGCCAAAACCTCTTTCTCGGCTTCATGATATCGTAGCTCGGCGTCGTGCAGAGTACG
ACCGGTAAACCGGACCGGATGCAACAACCCATCGTGTTCCTGTGCGAGGACTGCGCTCACGGCCCATGGCACGGCGTGGATCAAGATCACAAACGGCTTG
TCCTTGTCAGGGTGTCTGAGAACCGGCGGGCACGTGATCTTCTGCTTCAGCACTTCGAAAGCCAGCTTTGCCCGATCCAGATCACGACCTTCGCGCACTT
GTTGGTCCGTCAACTCGTACAGACTGGCCGCGATAACCGGGAAGTCCTCAATGAACTTGCTGTAATAAGTGAGGCTACCAAGGAAAGACTGCACGCCACG
CAAGCTGGTGGGGAACTCGAGCGAATCCAGTTCCTTCACGATCTTAGGCTTCGCTGCAAGGCCTTCTCGGTCGACACGATGAGACAGATAGTCGATTGCG
GTTTTCCCGAACGAGCTTTTGGGCAAACTCACCGATACTCCCCAGTAGCGGAGCCGGTACAACAGCTTGTCGAGTTGCTTGCACATGTCTTCCCACGTCG
CTGAACCAAAACCAATGTCGTCAATGTACGACGAGCGACCCAAGACAGGCCCCATTGACTTTGGCGACGGAATGTTGAGCTCGAACACCGTCGAACCTGT
GTTCGCACCCGGTTCCTCGTCGGCCGTAACCGGTTCCAGGCCCAGAGCTTCAATCACTTCCGCTTCGACCTTCGCTTCCAGACTCGGCGGCAAACTGACG
AACCCCCAAAGGCAGTTAGTTGTCAATCACGCGCTGGTATATAAGAGGCGCGTTCTTGAGCCCGAAAGGCATGCGGATCCATTGGAAATGACCAAGCGGA
CACACGAACGCACTGATGTGCTTCGCTCGGTGCGAGAGCAGGATTGCCCAGATGCCACTTGCCATATCCAGGCTACACAGCCACTTGACGTGCTCGAAGT
TGTCGAGCAGCTCGTCAATAAGCGGTAACGGGTATCGCATGAGCTTGATCAGCATGTTGACGCGGCGATAGTCCACACACAGCCGGATTGTCTTACCNNN
NNNNNNNNNNNNNNNNNNNNNNNGTCTTTCTTCAGGACGATCACAATCGGACTGGCCCACTCTGAGTCAGAGTACTCGATCAGCTCAGCCTCGAGAAGGG
TCTTCAAGAGGTCGTAAAGCTGCGGGAGAAACCGGCCCTGGATGCGACGTGCTTTCTCGGCGACCGGAGTCGTACCCGGTTCCACCTCGATATCGCACAC
GACACCACGCGCCGGAGCCGGCAATGCGTTACCAGACGAGAGGAAAGCGGCCGAATGATGATCGAGTATGTCGACAAGCATCTTGATAAGCCGAGCATGC
TCATCTGCTGCGTCCGCTTCCGGTTCGCCTATGCCCGCTGTGGTCATATCCGGTGGAACCTTGTCAAGCGACAGCTCGGGGAGCATCGCCAACTGGTCCC
GGAGCTCTTCGAGCGAGATTTCCCCTGTCCCTTCATGAAGAAACACTTGAGCATCCTCGCCTTCGACCAGCTCCGACACGG