Description :
From Genome Similarity Track
Location :
Scaffold_330:558- 3093
Sequence
2535 bases(100 bases per row)
CTGGAGACATCCAAAAGCATGTCGTTCTGAATTTTCTCTAACTCGATTCAAGCTCCGCGGAAACTTCATGTCTTCCATCATCAATTCGAAGGAGCTATTC
CGCAAATACTTGCACATCATGGGCTGTGTCAGGATTGACGGCAGCCTGAACGCGCATGGCGATAGATAGGCGCGGATACTCCACAGCTCGGGGCGTTTTA
GAGAAGCAGAAATCACTTCAGCAAGTCCAGTGGGTGTAGTAACCGGAGGCTTCTGTTTGAAATTCCCTGACAGCAGTATCGTGGCATCACCAAAAGGCAT
GTCATTCTTCAGCAAGCCGAGAAGCGTTCTGTCCACAACCTCGTATTGGCATCGTTGGTCCATCGGCGCTTAGTCCCAATCGATAAGGCGTGTTCACCTG
AGCAACTCGGCCTCCGAGGGCCGCACACCAAATTTACAGGTGGACATCACGTCGGGGTCTAATGGAGCCAAAACGTGAAGTAAGTCGTACAGCTTCCAGA
GAGAATCTGGGCTGAAATTCCGCGCCCCCGAAGGCAATGCTTCCAGCGTGTCGTACACTTGCCAGAATCGCTTCAAGAAGGGACGACGATTCATTTGGTG
TAATGTGGACCAGCTGCCCCAGGCAACCTATGGACTTGCCATTTTCGTGCGCGAGGCGAGGACTACTTCCGCAACATTCTTGAAGCGTACAACTTGAAGT
GTCTTTAAGGACATCGCACGAGAGACATGATAGTGGACCCGTCTGCGGTGGAGAGAAAATCAGAGTCTTTCGCGCTGCCTATATCTACTTGATCTAGAAC
GGGCAAACTTGGCCTCATGCTGCAACTCATTTCCGCTACGCTTGACATTCGGTGATGTGGAAACGGAAGAAGACGTTGGAGATGAAAATTGCTATCGGTT
GTTTGCTCGAAAGCGTCGCATGAGCCTACTGGTCTGGATTGCAGCGCGGATACTCTCGATACTCTCAACGTCGATCCGAGAGTCGTGTTCGACAACGTCA
TTAAGGCAGTTCTTCCTGAGGGTACCGATGCATCGGATTCTCGTATTTGGGGGGAAATGTTCTTTCGCGATGTCCCTGGGCGAACAGATGCCTCATTTGG
TCAGGCAATTGAAAAGAGGTAGCCTCGATTAGGCACCGATGGTTCTCCTCGCTCGACTCGATGTTCCCCATAGCCAAAGACGACCTTGAAAAATGGTTGA
ATTGCTCCATCGACGGTTTTAAGATCTCCGAATGATAAGAGCCATGGCGATAGCACAGCAAAATCCGAATGTAGAACCGGTTCGCGTCTCGAGGCGAAAC
CGAGATCATACGCCCAATGTCTCAATCCCGCGCTCGCGGTACTTAACGATATCTATGTCCACATTCTCCTGACGAAACGAATGGGCACATAAGTTCCATG
GCAGCAATGCCTTCAGGAGAGTCGATGCCGCATATCTCGCAGAATGCAGTAAGCATCGTGAATCTGTTAAACTCCAATGCATCCTGGATTCAGCGGTAGT
CGACCAGTGAATCAATAGTTGGCCCGCTTCGTGAACAGGCACTCGATGCACATGGTTTGACTTCCTCTGCATGTCGTACTTGAAAATCGTTGAATAGGCT
TCCGGCGGCGACAAATAGTGGGCTTCGAGATACTGCTTGATTTCATTAATAATGTGCTAGGGTCAGCGACcgctgccccccccccaccctCCCCCTCTTT
GCCACCTATCTTTAAGCCCAATCATGGCGCAATTGTGTCCCTTGTACACGTACTTGTACAAATACTACACGGACTCCGCAGTCGAGTGTATTTCCACATT
TCCGTGACAGTTGTACCACTTCTGGGAAAAGTAGGGATTGTACGGGGCCACCCACCGGTtctcaacaacaacaacgcccccccccccccccccccccttt
cAGCCTATTTGGTCGGGGACGCCAAATTTGTTTGGACACGAACCGGACCGACAATGGTCGCTGAGGTCCTAGAGGTTGGTTGGCATCGATGGGCCCTGGT
TTACGTCATCAATTGAGTGGGTAGCCGTCCCCGTCAACTGGACCTCCTCCGCACTCCTTGAAAACTGGTTCGAGCAGTTGtcaacgacgccgacgcagaG
ACAGTTGATTCCTTTTCCACACAGCTCATGAATCACGCAAGTATAAATCGTTTCATACAGGTCGGGATGTGCCTCCCGATCAGGAATCTCTGCGCAAACG
TATTTGTCGTAGTCAAGCGGAGTACTGTGTTTAGAGGCACTTCAAAAATGACCAACAAGTGTGCATGTGACAAACCGAGTCTCTGGAACTCTATCACGTA
AACGAATGCCAAAGTCTTGCCAAAAGCACGTTTCTTAATGAAGTCGTCCAGAAGCTTTATTTTTAACACACGCACCACGATGTCGGGGCGATCAGACGTA
ATTTGACCCAAGAGCAAACTTACCTGAAATTTGCTTCATCGTAGTCACGGTGATGAGCAAGTCCGGCTTACCATACTGCCGAACAATCGCCATAGAATCG
TAGTACTGTTGACGCATATACCCGCAACCAACGAA