Description :
From Genome Similarity Track
Location :
Scaffold_1097:558- 1949
Sequence
1391 bases(100 bases per row)
GTCAAGTCAGCGTTAATAGACCGAGCAGACTCCAGCTCGACCCTCAGTGCAGCGACGTCACTAGCTTGACTTGACGGTTGGCGCTGACCGCGAAGGAGGC
TCACGAGTTCGCTGACGGACGTCGCCTCGAGGGCAGCTGGGCGGACCTCTCTATCAGCCGCCGGTGCGGGACGAGTGATCACGAACCCTAGACAACAGCC
GAACCAAGTCCGCGTTCTCGATGCGGCGTTGCTCGGACTGCGCATGGATCAGCGCAGCGAGAGAGTCGAGACTCATCGGCGCAGCCGAGGCCGACCGACC
AAGATCGGCGGCGTCCGAAGTGGTGTCGCCACGCGGACTCGGCGAGCGGCGAGGAGAAGTGCGAGATGCCGGCTCAGACTCCCGGTCGAACCCACGGGAA
GTTGTCAGATCGATGACAGGGTGCTCCTGCCCATCGCTGACCCCGCGATCCCGGGACGCCGAGTCGACCAACTCAGCGAACTTCCCCTCATCTCGCGCAG
GAGGATGTGAAGACTGCAAAGACGACGCAACTGAAGTCTGTGAAGATCAGTAGAAGAAGGGTCAGCAGCAGAATGGATGGAGCCGTCGGAGGCGAGGAAC
GTACGGAGGAGCGGCAGGAGCGCCGGACGACGACATGGCGCGGAGACTTGTTCGCTGCCGTTGGAGTTTTGGCCGAGATTGGACTCGACTCAAGGAGTGA
TGATCAGGTCCCTCACCAACTCGGCTCGGAACATGACCGGGGCAGTTGTGGTGTAGAGAACACCATATTTCGCGCGACCAACTCGGCTGGAGTGGTACAC
TGTACCGGTAGCCGAGCTCAGCCGAGTTCACCAGCTTATCCGGACACCTTATCCGGCTCAGCCGAGTTCGAAGAATTATCCGGATAGCTCATCCGGACCA
GCCGAGCTCAAGCGTCGCCGAGCTCAGCGAAGAGTCGGCCGAGATCCAAAACCGCCCACTTTCATTTGGTATTTGAATAGGAGCTTAGGAATAGTGGAGG
TGCCCCTTCAGGGTGCCCGACAGAGATAACAAACAACAGAGCAGAATTTTCTAGGTCCACAACACGTGTACACGTTCCGGTAAGTCCCTGCACGGGGCTG
GATTATGTCTGCTGCCGGTACCCGAGAGGCATAGCTTGTAGGGTACTCGGCTGGCAGCGCCAAGAGATTAAGGTCGGCCCGGGTTGGGTGCGTGTCTCGC
CAAGCGCGAAGGAAAAGTCTCGCCACCGCTGCGAGCCGGTGTTCACGTACGTCCCGGGCACTGATTGCTGAGTCGAGAAGCCTTTGCTCTCGGTGACCTG
TAAAAGCGCTCCGTGCGCCGTCGTCCATCCTTTGGTGGAGGGCACAGGGTTAAGTGAACGGAGGCCGTCGAACTCGGCGGCTCTCCGGAGG