Description :
From Genome Similarity Track
Location :
Scaffold_2506:558- 1923
Transcript NameFunction/comments
Phyta_totarag14564hypothetical protein PHYSODRAFT_332751

Sequence
1365 bases(100 bases per row)
GTCGGCGGTAGCCTGGAAAGCGAGATTCTGCCACACCATGTAATGACGAGATCCGATCGACACGAATcctggaagacgaggaacacAGTCGCTGGCGAGC
CAGATCCCGATCCTCTCATCGCCCTGCAAAATCAATTTCTTTTCGCACACGTTGGCGATCTGCAGAtgtcgtactcgtccagGTCCTTTAGTAACCGTCG
GTAACCAACGTTCACCACGGGTGATCCATAACTTCTCATGCTCCGACGTTCGCAGGCGCATCCGGAGCTCCACCGACTCTCCGATCAGGATCTGCTTATA
CTGATCCAGTTTCAAGATCATCGCCTTGTCATTACAGAGCTGTCGGCGTCCGCTGAGTCGGATCTCTACCTCGTCAGGCAGGCGGATCGACCCGACAGTC
AGATCCAGTCTGATCTCCGCAGGaaccatgaagtccatgccTAGGATGGCTTCCTGGCCAGATAGATCGCCTACCCAGATATCGAAGAAATACGCCAGCC
AGCCCGCAAGGGTGACCTTGATCCGAGTTCTGTCTTCCGTCGTATACACGTTCTCACCAATTCCAACACACTCTTGATTGTGACTCGTGTCGATATAGCA
CCCAACCTTACGAGCAAAGGCAGTGTCCACTATGGACACTTCGGCACCAGTATCTAAAAGTATGATAGCCTTCTAATTGTTGATTTTGCCAGTGATCTTG
GCTTGTCAAAAACCATTTGCCCGGCGCATGATGTTTCCAATATCCTCGGGATTCTCCAGAGAGGAGATCCGTAGATCTTCCAGCGTCGGACCTTCGGTAT
TCATCAACACGGAGTAGACTTGGAGGTCTGGATGTGGCCTCGCCGTCGCCCGGCTTGAACCACTTATCCGGATCTTGCTGTTTCCAATATCCCCTAGGTT
CCCCAAGATGGAGATCCAAGGACATGGAGATGTCAGATCTGGTATATTCGTCCGCTTGGCGAAGACTTGAGACCACTGCAGTACATTCCCCGTGCagatt
acatgtattatcgGATAGATCTCGTTGCTTACTAACTCGATCTACAGATGTCTTGTTCACGAATGCATAGATGCAATACCTAAAACGCTCGGCACGTACC
GGATTCCAACCCGGCGAGCGCCCTAGTTTAACCTCTTCTTAGCCATCGCGGGCGACATGCCCGCACGCTACTTTGGATTGTACCACTGGCGGATCTGGTT
GTAGAACTCTTCCATTGGGAATTTGCCCACGTCATGAAGCTCACCACACTCACGGCACACAAAAAGGCAGTGATCCACCAGATGGCCCCGCTTGCCACAC
TTCTGGCACGTTAgacgtctccagcagcccaGAACCGTGTGCTTGCGAGATCCACAATGGATACA