Description :
From Genome Similarity Track
Location :
contig_2:557949- 559011
Transcript NameFunction/comments
g696.t1OWZ15971.1 putative mitochondrial protein, partial [Phytophthora megakarya

Sequence
1062 bases(100 bases per row)
TTTCCAACACTCCTCCTCGGCCGTCACCTACGTCAACTTGACGATTTGGCGCAACTCCGCCATCCTGGGCGCCGGGAAGGCCTTGGTCAACAGATCCGCC
TTCATCAGATGCGATTCGACGTACTTGGGCTCCACGATGCCCTTGCGCGCGTAGTCGCAGATGAACTTGATCCGGATACCGACGTGCTTGGCGCTCACCA
TGCTGTCCTCGGACTCCAGCTGCTTGATGGCGGCCTGGTTGTCCATGTGCATGGGCATGGGCTGAGAGACGGCAAAGTGTAGCTCGCGCACCAGCTCACG
TAGTCCGAGCAACTCGCGTCCGACGTGGGAGGCCGACGTGAACTCGGCCTCCATCGTTGCCAATGATACGCCCGTCTGCTTCTTGCAGATCCAGTGCACG
ATCGCTCCATCCATGGTGACCACGCCCCCGGTCACCGACTTCCGGTCGCCCTTGTCGGCCGCGAAGTCCGCGTCGCTCCAGCTCTCTACCTGAATGCAGC
GCCCGTCGGCCACGCCGACGTCCATGCGGAGCTTGAGGGTCTTGGTGGCCTTCAAGTACCGTGCGATCCTCTTCGCGAGCTTCCAGTCGCTCGTCCGCGG
CTGGTGCGTGTACCTGGTCGCCTTGTGCACCGCGAAGCTGATGTCAGGCCTGGTGCACCGGGCGATCCAGAGCAAGCTGCCGACCAGCGACTGGAAGGTC
CGAATCGTGGGTTCGCCGTTGGCGCCGACGCCCTGCAGCAGCTGCAGCTCTTGGGGCTCAGCGTCGTTGGCCTCTTCGCCGATGGGCGTCTTGACGCCGT
TCGCATCCGCCAGACCGAACTGCACCAGCAGCTCTTCAATGGCGGCTTGTTGGTCTAGGTTGTAGCCGCCCGCCTCGTCGAGATGCACGCGCATCCCAAT
GAACTTGCTCCCCTTGCCCAAATCCTTGATGGACAGGATCTTCATGGCCACAAAGAAATCCTCGATCAGGTCCGGCTTGGACGCGGTGACCAGCAGGTCA
TCCACGTACAAGCCCACGATGGTCATGTCGTTGCCGTCGCGCTTGTAGTAGAGGCACATGTC