Description :
From Genome Similarity Track
Location :
contig_66:55792- 57145
Transcript NameFunction/comments
g11282.t1hypothetical protein

Sequence
1353 bases(100 bases per row)
GTATATTTGCTTCTTGATAGCTGGCACACACGCTATTTCGCTTCTGCGAGAGCACGGCAATTGCATCGGCTAGTCCGTAGTGTAGTTCAGAGGTGCCATC
ACCGTGGGCTCGAGCACGTAATCTTGCAAGCTGCGAAGTCAGAGCATTTGCCAGAGAGCGATAGGCATCAGCTCGATACTGCAAATTCTCGTATCTCTCG
CAAAGCTGTACTAGAACATCGCACTCAGACAAGCGCCGCTCAAGTGCCTCCGCAGCTTCGCTCTCACTGTGTGCCTTTGAAATCGGACTTTCATAAACAC
TGACAATGTGTCGCTGCGCCAAAATATGTTGATGAAGGTCGCCTTCTTGCTCAGCGAGTGCACGTTGTTTAAGAAACACCTCCAGAGGCTGCATGGATCC
CGTCCCGGAGCTCAGTCCAGCTGCCGCACCCTGTCCTTCGAGCAACAATAACTCCCGAAGTGCGGAGCCTAGACCCGAATACGCCATCAACTGTTCACCC
TTTAGATCCAGTACGACCGCTAGCTCAAGGGCTTCACGCCAGAGCGGGATAGCTTCCACATACCGCTGCGTAGCGTTGTAGACGATTGCCAAGTTACGCA
AGGCACGATGTTGAGCATGGAGATCTTCCTGTCGAAGCGCCAACGCAAGGTCGCGTTTGTGTGAGCGCTCTGCAAACTCAAACTTGCCCTCAACCAGTTG
CGTGCAACCGGTGTAGCTGAGCAGCAAGCCATGAAGTTTTGCTAGCTCCGAGTCGATTGGCGGTAACGTGGTCTCCGACGCGGCGACGTCTTCAACTGTT
GCGGTGTTCATCTCTGCCATTGCTGTAGCATCAGCCGTGGCTGCTGCATTCGCATTCTCGTGCTCGTCAAGATCGATTCCTGTGAACTCTTTCAGCTGGC
CCATTGCAATTGAAAACTCAGCTTCAGCGGTGTGAAACTCGCCCGCATAATACTCTTCTTCGCCACGACAACTCTGCGCGAGTACACGAAGCGCATTATC
GGGCTCCGGCAGTGCATCCGTTAGTTTCTCACTTTCTAGGAACATGTCTTTCGGTGTTTTTGGTGGGGGTGCGATAACTGGGACTTCAATCACAGCTGCA
GCTTGGATGTCGGAACCAGGCATTGACGCTGTCTCTGGATCATTCTCTGTAGGCCCACTGGTTTCTGGTGGTGGCAGTTGCAGCTTTTGTTGTACCTCCT
CAGGGTTCTCTTCGTCATCTTCGTCGTCACCAATGTCGTGCTTTACATTCACGTTCCGACCGAGGTATGCCAGCGCAAGACCCAAATGATACTTTACAGT
CGCTTGCTGCTGGAAATCCTTTGTGTGCTGCGTGGCACGGTATGCGCTAGAAA