Description :
From Genome Similarity Track
Location :
scaffold_1:55779- 57129
Transcript NameFunction/comments
g17.t1hypothetical protein

Sequence
1350 bases(100 bases per row)
TCGGCACGGGACCTTGCAGTCTGGGCATTTTGGGCGACATGTTGAGAGCTTCATGTGGCAGTACGCGCACGGTGGGTCATCTTCACACGGTGTCAAGAAT
GGACCATTCCGAACAGGGTGTGCCTTATCATCACACTACACGTAGAAAAAAAAAATCATCAAACTCAGCACACACAGGGTGAACCATCAGCAGCCTTACC
GGAGTAAAGAATGGCGCTTGTTGGCACTTTCGAAGCGGTTCCATGAGCGCGTCTCGAACAAGCACCGAGATATCTGAACCAGAGCAGCTAGTGAAACGGC
AAAAATGAGTATCAACACCCTCTTGTCGAGATCTGAAACATCGTACCCTTCCGTCTTCTCCGCAATAGCTGTGAAGTTTGCGTCGCTCAGCTCATTTGGC
GTATCACCTAGGTGAATTCCCAGCATTACCTTCCGCGCATCAACTTCAGGGAGAGGAATGTAAATGCGTTTTTCGAATCTGCAGGTTTGTAACACAGCAT
CAGCTATCTGCAATTTCCCTCCCCCTTCTTTCAACGAACAAATATTTACCGTCGTCGCATTGCCGGGTCTAGTTCCCATGGTACATTCGTAGCTCCGAGC
ACCAGAACGCCGTCATGGTTGTTGCCCATCCCCTGCATCTGAACAAGAAATTCGTTCTTGATGCGACGTGTTGAGTCACTTTCACCTTCGGATCTACTCG
AACAAAGCGAGTCGATTTCATCTATGAAAATGATAGCAGGTTTCTTCTCACGTGCCATCTCGAAGAGGTTCTTGACCAACCTACAGCGTAAGCCACGAAC
GAGTCAGCAATGATAAACTGTAATCTCCACTGTATCGCAATTAGATTTCGCACTTTTCACTCTCGCCTTGCCACTTGGAGACCAAGCTGGAGGATGATAC
AGCGAAGAACGTGGCGTCCGCCTCCGTTGCAACGGCCTGGGCCAGGTAGGATTTACCGGTACCTGGGGGCTACAAACAAAACCCAGTTTAGTGCAATCAA
CTTCAGCGACGCCTACAAATAACCCTCAATATCTTACCCCATAAAGCAGAATACCCTTCCAAGGACGCCGCTTCCCTGTGAAAAGCTGCGGGAACCGTGC
AGGCAAAATCACTGCCTCCTTTAGCGCCTCCTTTGCCGCATCGAGTCCAGCCACGTCGTCCCATTTGACATTAGGCTTCTCGGACACGACCGCCGCTGTA
GCACCATGTTCAAAGCACTGTCAAAAAAAGTTGACCAGCCTAGTGTGCACTCTCTTCAAAACCTTACAGGACAATGCACCGCGCAATTTGGCTGTCTCTG
CGTCTGTTTCATCTTCGTCATCCTTTTCGCCTCTGCATACAGCTGTATCA