Description :
From Genome Similarity Track
Location :
Scaffold_310:5577- 9890
Transcript NameFunction/comments
Phyci_295083hydroxymethylglutaryl-CoA synthase

Sequence
4313 bases(100 bases per row)
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNGTGCAGATTAGTTTGTCTAGGCTGCGTTCTTCCTGCTTCGACCGCCACTACGAGAGGATGAAACGACGCAACTG
CGCACACAGTGGATGACGCGTGGATGTGGTGCTACTGGTTATTGAGCGCGTCCTCTCTAACAAATAGATGTGCTCGACATTAGTTAACTACTATCTACCT
TGAAGCTTGCTCTGCAATCGCTATAAAATGCACTATTACTGGTATTCTACGTTACTGTAGTCTGTAACGTATTTCATCCAATCCGCTCGGAGACCAAACA
TGTGTGTCGTACACAACTGCTAATCCCACGCTACGTACGTGCATGTACCCGGCCAGCACAACGCAGCAGCCCAAGCAGATCGCAGGCGCGAACGAGAGGC
CCGTCGTCCTTCGCTCCGTGGATCAGTGGACCTCCCTCCCATCCACCGGCTCAGTAGCAAGAGGCAAACGGATACAGCAGCAGCAATGGTGAGCTCTGCG
CGCCCCAGCGACGTGGGCATCCTGGCCATGGAGGTGCACTTCCCCTCGGACTACGTGGACCAGCGCGAGATGGAGGCCTTCGACGGCGTCGGCAGCGGCA
AGTACACGCTGGGCCTGGGCCAGCTGGGCATGGCGGTGCCCGGCGACCGGGAGGACGTGAACGCGCTGGCGCTGACCGCCGTGGCCAGGCTCATGAGCAA
GTTCCACGTGTCTCCGGAGCAGGTTGGACGCCTGGAGGTGGGCACGGAGACGCTGGTGGACAAGAGCAAGTCCACCAAGACCGTCCTCATGCAGCTCTTC
GGGGACAACGCAGACGTGGACGGAGCCACGGTCATCAATGCCTGCTACGGTGGCACCGCGGCGCTGCTGAACGCGGTGGCCTGGGTCGACAGCTCCTTCT
GGGACGGAAGATACGCTATTGTGGTGGCTGCAGACATCGCCGTGTACGCCAAGGGCCCGGCGCGCCCCAGCGGAGGGTGCGGAGCTGTGGCGATGCTCAT
TGGACCGGACGCGCCCATGGTGCTGGACTGCAGGACCAAGGCCACCCACGCGACCAACGTCTGGGACTTCTACAAGCCCAATGTGAGCAGCGAGTACCCG
ACGGTGGACGGCAAGCTGTCCAACTCGTGCTACCTCCACGCAATGGATGAGTGTTATCAACTCTTTTGCAAGAAGAGCGGGAAGACGGAAAATGGAAAGG
GACCTGGCGTCGACTCCGTCGACTACGCAGTTTTCCACTCGCCGTACAACAAACTGGTGCAGAGGTCTTTCGCTCGGCTGCTGTTCCTGGATTCGAGGCG
TTTGCTGGGCGAGAATGACGAGGCTGCCAAGGAGAAGTTTGCCTCCCTGAGCAAGTGGGCGAACGCACCGTTGGGAGACACGCTGAACAACCGCGAGCTT
GATCTGGCAGTTCGTGCTATTGCCAAGGATGATTTCAAGAACAAGGTGGGGCCAAGCTGCACCACCTCGCAGCAGCTGGGTAACTGTTATACGGCAGCTG
TGTACATGAACCTGGCGACCTTGGTGCATGCCCGTGCCAAGGATCTCTCCCTAGGAGCCCGTGTGCTCATGTTCTCGTACGGCTCGGGTAGCCTTGCCAC
CATGTTTGTGCTTCGAACGCGTGAGCCGACGGAATCGTCGAAGGGCAAGTTCTCGCTGGAAAAGATCGCCGAGGCGCTGGATCTCACCGCTCGACTTGAA
AGCCGCAACAAGAAGACCCCGGAGGAGTACACGGCACGCATGAAGTTGCGCCAGAGGACGTATGGTACGAAGAACGGCTTGCAGCTCACACAGTCGATTG
CGTCCATTCCTGAAGGCGATTTCTACCTTGACCGAATTGATGACATGGGCCGCCGTTCCTACGCTCGCTCGAAGCCGGTAGTGACTCCTGAGGGCGCCAA
GCAGGAAAAGCAGCACGTCACGAAGACTACGCATGAGCTTGCTGGTGCTGTCTACGTGACTGGTACCAGTGCTGGACTGCCGGGTCAGACGAAGGCTTTC
GAGGGCGAGCAGTCTGTTGAGAAGCTGCTCGCAGGCGAAAACTGCATTAAAGAGGTAACTGATGCGGCTAAGGACAAGATGGTTGCTCAAAACATTGTGC
AGGTCATCAAGGACAAGACTACTGGTGAAATGACCCGCACGCCGGTCGCCACCCGTGAAAAGTGTATCCAGGTATCCGCCGTTGTGGAGCACGTTGATCT
TGAAAAGGACTATGGTATCGCTGCGACTATCGCCCGCTCAATGGACGAACCCACGCAGTTGGCTGTGGCTGCTGGCTTGGAGGCTGTTCGTAACGCTGGC
CTCGTCGACGAAGCCAGCGCCAAGTGGCAGTTGCCGGAGAGCATGCGCGACTCCACAGGTGTCATCTACGCCACGTCCTTCCCTACCATGAATGCAGCGG
TGTCGGAAACCTCTCGCTTCTACGAAGAAACAAAGGAGGGTGAGGCTCCTTACGAGATGGATCGCAAAATTCTTTTCCGGTTGCTGGTGCTCGCGAACGC
ACAGGTGGCTCAACTCACTGGTGCCCGCGGGCCCAACACGCAGATTAACGCGGCGTGCGCTGGTGCTACCCAGGCCATTGGCGTCGCCCAGGACTGGATC
AATTCTGGCAAGTGCCAGCGAGTGATTGTCGTATCCAGCGACACCGCTAGCTCAGAGACCATGATGCCGCTGATCGGCGGTGGTTTCCGTGCTTTAGGTG
CAGCATGCATCGCTCCGACGGCGGATGCTGCGGCGCGTCCGTTTGACGCGAAGCGTAGCGGTATGATTGTCGGCAGCGGAGCGATCGGTGTGGTGCTAGA
ATCCCCTCTGGCTTACGCGGAGCGCTCGGTGGCGGTTAGTGGGAAGCCTGTACGTTTGCTGGCCACACAGTACAGCAACTCGGCATATCACGGTGCTGCG
TTGGAGCCTAACCATGTTGGACAGGAGCTCGTGCGCTTCTTGCAGCGCGTGGAGACTGACTTTGGAATCACTCGCGAGGAGATCGCCCGCAATGGCGTGT
ACTACAGCCACGAAACTGGCACCAACGCGTCGGCCAAGTCATCGTGCGCTTACACGGAAGTGACTGCGTTGCGCACGGCTTTCGGCTCAGAGCTGCTTGG
TGAACTCATGATCGCGAACACCAAGGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNAGGTCACTGATGCGGCTAAGGACAAGATGGTTGCTCAAAACATTGTGCAGGTCATCAAGGACAAGACTACTGG
TGAAATGACCCGCACGCCGGTCGCCACCCGTGAAAAGTGTATCCAGGTATCCGCCGTTGTGGAGCACGTTGATCTTGAAAAGGACTATGGTATCGCTGCG
ACTATCGCCCGCTCAATGGACGAACCCACGCAGTTGGCTGTGGCTGCTGGCTTGGAGGCTGTTCGTAACGCTGGCCTCGTCGACGAAGCCAGCGCCAAGT
GGCAGTTGCCGGAGAGCATGCGCGACTCCACAGGTGTCATCTACGCCACGTCCTTCCCTACCATGAATGCAGCGGTGTCGGAAACCTCTCGCTTCTACGA
AGAAACAAAGGAG