Description :
From Genome Similarity Track
Location :
Scaffold_22:5577- 9536
Sequence
3959 bases(100 bases per row)
CCGAAAAATACATTTCCAGTGACAGAACCGTCGTATGCGTTGGTAGGTACACCCAATTCCTTGATGACCCCCTTTTAAACTCTTATGGTAGTGGTGGAGC
AAGTTAGTCTGGAGACTTTCCGGTACCACCAGTCTGACCGTCATGTCGCGGCCTTCTCCCTCGACTATAGAGTTGGACAATACACCAACAATCCTTACTC
GCTGATATCGTAATCTTCGTACATTTTGCTACACTTTTTAGCGGATTCTACCGACAGGTCTCTTCAGTCCGCCTTCAAATATGCATTCGAATCTCCTACC
CAGCTCTCCTCTTCTTGCGCCTTTCGAATTCGTTGCATGGTCCCTCCAGATATCTCAATAGGAGATCGCGACTGAATTACCACAAATATTTTAGTATAGA
GACTCTGGTCTTTAGGAGCTAGCAGCTCATCAGACGATTGATCACGTCCAATCCTGGTCTTTCTTCACTCGGCATAGACTTGATCTCCCCTTTCTGGTAC
AAGGCTGTACTAGCCAACTGATTTGCGCTTCCTGGTTCCAGTCTCGTTTCACATGCTGGATCCCGTGAGAAGTCCACGATTGGAGTTCATTTGAAGCCCG
GTCTCGCAGTGATGATAGACCCTAGGCCTTACACTTAATCTCCCGTCGCATATGCCGTACCACTAATTTGGAGTCTCCACAGATAATCAACCGCCGCCGC
TCCAAAGTTTTCAATAAGCTAAATCCAAGCAACATACTATCATATTCTGCCTTATTTACCGTAGATGTATCGACATATTTGGAGGCGGCTTCGACTATGG
TCCAAGCTGAGAGTCTCCATACGATAGCGCTAAAAGCCCCGCCTCCTTGCTTAACACGGGCCAACCCATCAAAACGCATTACATATAGTTCTTCTTCCGG
TTCTACGGTTGGGGTGGGTAGGTTGATCGTCTGCCATGCCTGATTCTTAGGGGCAATGGCCGACAATATTGAGTCTGCACTCTATCGAAGGGTAATACTA
GCTTTCAATGCCCCCAACACCTGGTCTTCACCTTTTTACACTTCACGATCTCCAAGGTCCACTGAGCCTAGAGAGCGTCCCAGTTTCCCAAACGCCCCTG
CAAGCCGGCAGATTTCACTAACTACGTCAATGTCGAGTATCACGTCAAGACTTTTAGGGGCTGAGTGACCAACATGGTGAAGCAAGTTTCCAGTATACGT
AATAAGACTAACACTTCTTCCTCTACACTACTGTAATATAATTCGTTAGCCTTGAGAGTTATGCTTGTAAAAGCCGGCATAAGCAGTTCTTCATAATACT
TTACCAGTGACGCCGAAATGGCCCATTCACTTGCATAGACAATAATCATGGCTTCTCTGGTCGGGTTGAAGTTTCTCAGAATTGGCGCCGTGGCAATTTT
ATTCTTAAGCATGGCGAAGGCCACTTGGACACGGTCCACCTTTCTTCTTGTTCATCCTGGAAGTGGCATTGTTATCTCGTTTTAACTGGTTTCGTCGGGC
ATGAAAGTCCACCTAGCTCAGTTCTTAGAGAATAGATGCATATACTGCATAGTCTTCAATAAACCTGCTATAGTAGTTCGATCTTCCTAGATAGGATTGC
ATAGCTTCAGTGTCATTGGTAAAGGTAGGTCGACTAGAGATTGAAGATCTTTCGGGTGAGCCTCTAGTCCTCCACTAGATACTCGATGCCCAAGGTAGTC
GATCTTCCGACATCCCCACAAACCCTTGACTGCGCAGATCGACAAATTCCAGTAGTCGCACACATCAAGCAGTCGTTCCACTTTTGTGCACAACGCATCC
TATGATTCGACAGGGATGTAATCTATATATGACCGCCGACTCAGGATCGAGGAACTAGACTGCTCATCTGGCTCTCTCACCTTTAACAAATCCTCTGACA
CATCTGCCTCTGCTTCTGGAGGTATTCGCAAAAAACCATATAGAGCGTTATTCAGGAGTTGCTAATATATTTGGTGCGCGTTCTTAAGCCCAAACGGCAT
CCGCATCCATTCAATCAGACCCAGTGGAGGCAATGAACGCCAAAATTTTTGGCTCTCTCTCTCATTCATACCTAGAAACCACTTGCCATGTCAAGCGAGA
AGTACGACAATGCTCAATCCAAGTTTTCGAATAATTCATTAATCAAAGACATGGGATAGACCTAAGTTGAGTCAGGTCATTTACCAACCTATAGTCGATG
CACATCCTGATGTCCACCTCATTTTTCTTCACAATAATAACAAATGGGTTGGCCCAGGGTGAGTTAGACGTCTGTACAATTATCACAGATAACATCCCCT
TGATCAGGTCGTCCAACTTCTTCTTGAATTGAAGACCACTTTTTGTGCGCGTTGCACGTTGCGAATCGGATTTGCATTTCCCACATCAATATCATATATA
TCCCCTCGGCCGGCTGGCGGTAAGGCATCCACTTTTCCTATCAGCAGATGTCGTCTTTTCCATATAATCTGTCGTAGCGAGTCGACATCTTCTGGATTGA
TCCCATCCGGATCAGGAATCTGTATATCTTTTAACCCAATAGTCTCAGAGCAGGAGCCCATCTCCGGTATTATTACCCATCATCGTTTATGTCTTCAGCC
CACAAGTCTCTACTTTAGAACGTATAAACTTGTTCATCGTCCCGTAGCGATTCATTGGCCTAGGCTTTTTCCTCATTGACTGCGATCTCTACCAGTGGAT
CGCCTTTGGGACCACTTCGTTCTTGAGGGATTTCTTCTCGTAGAAGTACCTCTTCTTCGCGTGACTGTTCTTTTCTCTCTGGTAGCGGCTGGTGTGACAC
CCCACAATTCATCATTTGGACTTAGGTCTTTGAACGTTGCAAAATATGCGACGGGATATTGTACTGCGGTGTATCCACCAGTGGTGTTTCTTCTCCTTCC
TCGAGGTCAACTTGGGGGTCGAGATGGTCAGTGGTTGCTTCATACGCTAGATTCATCCACTCAGCGTACCTTCAAAAACTCACTGAGACGAAATCTTGTG
CTCTTGGTACTTGATTCTACGTCAGCCACATACCTATCTTGGTGCCATCATGTGATATCAACGTGTGGGGGCTGACGTTGGTCACCTTCATCAATTGTCG
GCGTTCTATCCCCCGGGTCATTGTTGTAACCCGTCCCTCTCCTCTTGTGGCCCACATCTTCCATTGTTCTGAGGTCAACCTCTTTAGAGGTATTTCCACA
CACCCACCAGCAAGTATACACATATTGTCCCAACCTCACGTCTGAGACTCGGTTATTGTAGACGGTCCTCAGTCCAGAGAGTTGTATCCGGACTTCGTTA
GAGAGGCAGAGTGTTTTATCCACCAGGTCTAGCTGGATAACATCCGGGACCATGAAGTCCATTCCCAAAATCGCATCCTGAACCACCATAGGGCCTACCT
ACACCTTGAAAACGTACACTAAATTTCCATTTAGGGTGACCTTGATGCGAGTGCGCCCTTCCCGTGAAAGCACACCATTCCCCGATGCCAATGCACTCTT
TTTGTTCGCTTTTGACAATTTGACAGCCTATCTTACAAGCAAAGGCGACATCCAAAATGGATATCTCGGCGCCTGTATCGAACAACAAATTATCGCGATC
GTTGTTGATCTCCCCCGATGCTTTGGCTTGTTTAATCCACTTAGTAGGGGCATGATATTTCCAGTATCCTCTGGATTCTCCAGGCAGTAGTTCTAACTCC
ATCATTGCTTTTTCTCGGGCGAAATCATTAGGTTCACTGAGAGAGACAACATGGTCCATAGGGTATTCTACAATCTCCGATGTACTATCGATCTTCTCAG
TGGAAACCCCCCTCTCCTCTATGGGCTGCTTTTCCACGTATGCAACGATACAAAGACTAGAACGCTCGACTCATACCAGATTCAACCTGGCGAGCGTTCT
AATTTATCATCTTTTTCAACTTTCTCCGGCAACATTCCGGCGTGCTTGGTGGGGTTGTA