Description :
From Genome Similarity Track
Location :
Scaffold_558:5576- 7886
Transcript NameFunction/comments
Pytul_var.sporangiiferummaker-pug3_contig_558-snap-gene-0.10FK506 binding protein 15, 133kDa

Sequence
2310 bases(100 bases per row)
ATAAGTCCCAATGTTACCTCGTTTAGTAGTTTGCTTTTTGATTTGTTTGTCGACGTTCCGGTCGAGGGTCTACCTTTCACTTCGTTGGCCACCCTTTTTC
GTGCCAGATGCTTTACTGTCTGTGACAGGCGTATGTGAGTAAATGGACTTGTTCAGCTTCATGAAACGCAGCATCAAAAGTATCCCCACCTTCTTGCTTG
TGCTCTCGATGTTCGCCTTTCTCGTGGATGCTTTGCCGGTCTTCAAGCGCTGCCGATTGTCGATACTCGAAGATGAAGATAATTCGGAGTGTGGGGTCAA
AGACGAAGTTCGCCGCAAAGAAGCCATGTGGGCACTGTGTCTCGGAAATAATGCTCGCTGCTCTTCTTCACGCTGCGCTTTCCGATGGAGCCGATCTTCG
AGCTCGTGCACTTTTGCCTGCAAAATGCTTTCTCGGTTTTCTTGATGCTGGATATCATGCCGCAAGTTCAAGACCACTGATCTCATTTTCTAGGCATGCA
AAAAACAGCATACGAAATGAAAAGTTTTAAGAAAATCTTCCTTGCAGACAAATACGAGATTGGGCCTACTTCTTCCATCGTTTGCATGAGCTTCTGGTAC
TCTCTTGGGGAAGTTTGAGATTCACCTGCGGAATAAAGGTGGTCCTCACTCTTTCTCCGAGCGGGAGCGCTGGGATTTTTTTCAGGATCAGCTCGTTCAG
CTTCGCCCAAGACGTCCGAAATAATCTGTGAGCGTTGTACTTTTGTCTATTGCATATGCAATATCACTTGACATGTTCAGTAGACAGCATCATGCATTCA
TAGCATCAGCGCGCATTACCTCGATTGACGAAACGCTGTGCTCTAGCACGCGTAAGCGGTTCTCCATTCTAAAGCCATCGGAAAACAATTAGTTGAGGAC
CATGTCCTTGCAATGCTGGCAGCAATGTGACTTACGTGGAGGTGAATTCAACCATTTGTTTGAGCTGACACTCGGATTCTATTCGAACGGATCGCACCTA
AGCGCAACAGCAAGTCACTAACAGCATGCCTTGCGTCCCAGAGGTGCAACGTATGCACTTACCGCTTGCTCAGCTACAATGTCCGCATCATGGCGAAGCT
TTTGTTCAACTTCGCCTAATGCCACGAGCATCTTCGTGCGCTGTAGAATTAATATTCGGTCAGTGCCTTTTTGTGTCTGTGAAGCCAGCGGGATATGCTA
TAACAACACACTTACCAGCTCGTCTGCTTTCCCAAGTGATTCTTCTGTCAGTCGGCAGAACCTTTGCTCGGCTGCTCGCAGTCTCTCCGTCAGGTTTCCG
CAACTGTCCTGACTCTCCTGTTGCGCGCTCTGAGTGCAGGCTTGCAGGATCCGGAGTGCGTCTTTGAGTTTGAGCTGATTTTCACGCAAATCGTCTATTG
CCGAATCGACTTGGGTACGGTCGGAGGCAACTTGCTTCTGCTCATCGACGTCGTTCTGGATCGCGACCACCGTCGCGCTCAGCAAGTGTTGGGTATCGAG
ACATTTCCGCATCACGTCTCGCATCTCAGAGTGCTTGAGGTCGTGCTGTTGGTGTAGGTAGTGGAGTTTTTCCTGAAACCCGCTCATGCGGTCGTCCTGG
GCATTCCGCATGCGAATCGCGTCCGCTTTCCAATTCGTCTCCAATTGATTCGGAAGCTCCTCCAAGGTGTCATTCTATGCAAACCCCTGTGCTCAGTAAA
TACGCGTATAGTACACCAATGCAAAGTCATAACAACTGAGCGGACTCACCAATCGCTTCAGCTTGCTCTCCATGCTGAAACACTTTTCTGATATGGATGT
GCGCACAATATCCAATTCCTGGGCCAAGCACACCAGCATCCGCTCCATGGTGTCAGCGAATACAACAACAATAGCAGCAATGTTTGCCTCGCCTGCTGTA
CCTTATCGAATCGATCCGTGACAAGATTTTTGAGAAACTCGAGGTGTTTGTCGGTGTCCATAGACGAGCTGTGCATGCCTTCGAGCCGCGTCTCGAGCGT
AAACACGAGCGTCTTGATGTCGTCCACGTCCTGTTCTGTCCCGTGCTTCAGCTCCTTTAGCTCGCATTGCGTCTCGTCCGCAAGCTTTTGCAGAAACTCC
TCACAATGATTGAATCGCTCGTCGAGCGCATCCAACCGGCGCTGCTGCGCGTGCATGTCGTCGCCGTATTTCTCCATCCACGCCTTCCACTTGTCGTCGA
GTCCTGCGACATCCTGTCTCTGCTGCTCCGCGGTTTGCTCGATGTACTCCTGGTTCAAGCGGAACACTTTGGAGAGCGAGCTCACCTTCTGGTCGCTCGT
GGTCTGCGCG