Description :
From Genome Similarity Track
Location :
Scaffold_17:557414- 560381
Transcript NameFunction/comments
Physo_113916serine protease (predicted)

Sequence
2967 bases(100 bases per row)
CGGGCGAGTCCAAGCGCTGGCTGCAGAGCCTCGAGAAGTGCATCCGCGCCATCGTGAGCATCCGCCTGCTGAGCGTGCGCGCCTTCGACGGCAACGGCGC
CAGCTTCAGCGTGGCCACGGGCTTCGTGGTGGACATGGAGCGCGGCATCATCCTCACGAACCGCCACGTGGTGACGCCCGGGCCCGTGGTGGCCGACGCC
ATCTTCCTCAACAAGGAGGAGGTGGACCTCGTGCCCATCTACAGGTGAGGTAACAAGAGCTAAATCGTCCTCTCCAGGTGGACAGCGGGAAAGGAGGGAG
ATGTGGGGAACATTCACTTACGCTGTGCATTTTGATGCTACATACAGAGACCCAGTGCACGACTTCGGCTTCTTCCGCTTTGACCCCAAGAAGGTCAAGT
TCCTGCAGCTGCACGAGATCCCGCTGCGGCCCGAGGCAGCCAAGAGTGAGCTGCAATTTTTTTGTATACTTTTTGTACATTGACAGCTCTAACGTTTTGC
TTGTTGTTGCACAGTTGGCGCGGAAATCCGCGTGGTGGGCAACGATGCCGGAGAGAAGCTGTCGATCTTGCCTGGAATTCTGGCCAAGCTGGACCGCGAC
GCGCCGTCCTACGGCTCGGGCTCGTACAATGACTTCAACACGTTCTACTTCGCGGCAGCCAGCAGCACCAGCGGAGGCTCGAGTGGTTCGCCGGTGCTGA
ACATTGATGGATGCGCTATCGCGCTTAATGCGGGTGGAGCGAAGAAGGCAGCTTCGTCGTTCTACCTGCCGCTGGATCGCGTCGTGCGCGTGCTCGGACT
CATCCAGCAGGGCCAGCCGGTCCCGCGTGGAACTATTCAGACCATCTTCCGCCACACAGCGTTTGATGAGGTGCGGCGACTTGGCCTTTCCGGGGACACA
GAGGCGCTGGTGCGCCAGCAGTACCCTCAGGAGACAGGCATGCTGGTCGTGGACCAGGTTATTCAGGGAGGACCAGCACACGACAAGCTGCGGACGGGCG
ATGTGCTCATCCAATTCGCTGGCCAGTACGGAGCAACATTCCTAAAGATCGAGGACTTCCTGGACTCGCATGTTGGGCAGACCGTCGAAGCTCAGTTTCA
GCGCGGCGACGAGCAGTATACGACTACTCTGAGCATCCAGGATCTGCACTCGATCACGCCTGACCGATACCTGGAAATCGGAGGAGGCATTGTGCACGCG
CTCTCCTACCAGCAAGCTCGCAACGCGTCCCTACCTGTTGGAGGCGTCTATCTGGCCCAAGCTGGCCACATGTTCATGAAGGCTCACCTGGCCCAGCCCT
GCATCATCACATCTGTGGCTGGACAACCCACACCTACCTTGGATGATTTTGCGCGCGTTATGGCTTCACTCCCGAACGGCTTGCGCACAGTGTTGCGCTA
CTTCATGATTCGCGACCGCCACCGCGTTCGCACGGCCTTCATCATGATGGATCGGCTTTGGTTCCCGATGCAAATGTGCACGCGCAACGATGAAGACGGG
CTGTGGTACTCCAAGTCGTATATCCAGGATGCGACGAGCGGAGACAACTCATCTCTTGTCAACACTGCGAACTCAAACCCGACGTTTGCTCCAGCACCAC
TGAGTTTTCCTGGAGGTAACGCGCTGGGCAAGAAGACGCTACTATCGTTGGTGATGGTTTCTTTCGATATCCCGTACATGATTGATGGTATCTCGAGCTC
CAGTTACCACGGAATGGGCGTTGTGATCGATGCCGAACAGGGGTTCGTACTTGTGGACCAGAACACGGTTCCCATTGCGTTGGGAGACGTGCTGATAACG
ATTGCTGCCACCGTTGAAGTCCCCGCTAAAGTGGTGTTTGTGCACCCCGTTCACAACTTCTCGATCGTCCAGTACGACCCGAAGGCCTTGGGTGTTGTGG
CAGAGCACATCAAGAGTGTTGTGCTAGCGGACAAGCTACTCGAAGTCGGTGAGACTGCTGACTACATTGGATTGAGCAGTAACTGGACCGTGGTTACGAT
GAAATCTGTGGTTACGAAGCTAGATCGCCTTGTGCTTCGCGATTTCCAGCCACCTCGCTACAAAGCGTGCAACATCGAGGTGCTGCACTTTGACCGAATT
ACGAAGTCTGTGGGCGGCGTCTTTATTGACGACGCAGGTGCTGTGAACGCGCTTTGGCTTTCCTTCAGCTACCAAGACAATGCCGGTCGTAAGGAAGTAT
TCCGTGGACTTCCTATTAGCATTGTTCGCCCCATCGTCGACGAGCTCCGAGCGTCGCGTATCCCTAACTCAGTGAACATTCTCCCGGCGCAACTGTTGAC
ATACTCGCTCTCGAAGGCTCGTTCAGGTCTTGGACTCTCCGACGAGTGGATTCAGAAGCTGGGATCTTGCTACGAGGACAAGCGGCAAGTGCTTGGAATC
AAGCGGTGCGCTGCTGGCACAGATTGTGCCGGAAAACTTGAAAGCGGCGACTTGCTTCTAGCCATCGATGGCCAGGTCGTGGTGCGTGACGCAGACGTGG
AGAATGCCGTCGACGGTAAGACGGAACTAAAGGCGCTGGTGGTACGGGACCAGAAGGAAGTGGAGGTGACTGTCAGCACGTCCCAGCTCTCGGCTATGGG
CACTGATCGCGTGATTGTCTGGTGTGGTCTCGTTATCCAAAGCCCGCACTATGCGGTTGCAAGCTTGGGTTACATCCCGGAGGAGGGCGGCGGTGTGTAC
TGTTCGCGCTGGTGCTATGGCTCTCCAGCGCACAAGTACGGCTTGCGCGCGACGATTTGGCTCGTGGAAGTGAACGGTGAGCCAACGCGCACGTTGGACG
ACTTCTTGCGGGTTGTGGAACGCCTGGGCAATCGTGAATCGGTGCGGCTCAAGACCATTTCCATCAACACGAAGCCCAAGGTGTTTACTCTCAAGACGGA
CTACCACTACTGGCCTACGGTCGAGCTCCGCAGAGAGGAATGGGACTGGAAATACGTCGAGCACCCC