Description :
From Genome Similarity Track
Location :
Scaffold_287:5574- 8042
Transcript NameFunction/comments
Phyra_85701PREDICTED: sesquipedalian-1

Sequence
2468 bases(100 bases per row)
TCAGGATAACGCGTCCAGCAACGCTCCAATTCGAGACTCAGCAGCCTCGTGCGATTGGCGTCGACTACCCCATCGCAGCGACCCACCACCCCCTCCCCCA
CTACCGGGGCTATTGTCTTCTTTACGGCCTTCCACATCGATTCGCAACCACCGCGTAGATGTGCCGCTAGCGAAATCAAACTCTTGGATATGCCGAGTCC
GGACACGAAGCAATGGAGCAGGCGTCATCCCCCCTCCGCTAGCATCATTCGAATCGCCAAAGCGTTCTACATCGTCCAGAAGGTGGAAAGAGAAGGCGCT
GAACACCGTGATGAGGAAGCGACTTGGGTGCTCAGGCGACACGTCAATCTCGATGGGTCTTCCGCGTGCTTCGGCCGGTCGAATAATCAAGTTTGGGTTC
CCAAGTAATCGGTGCACCACAAAATACGAGTCACCTCCGCTGATAGTCCGAGCGCAGGCCTGCAACAGAGCACTGACAGCACGCACACGCTCCTCCGAAG
CGGCTGCAAATCGCTGGATATGTACATCCAGCACCTCGAAAATGTGCTCAAGGCCACGGTTTTGTTGTTGTTGTTGGCCAGAGGAATCACCTCCGCTCTG
CTCCGGTGATTGCTGCTGCTGTTGCTGCTCGCCACCACCATAAAGTGTATCGTTGATGAGAAATAGTTCAGGAAGGATGTCGCGCAGTGTCTGCTCGAGT
GAGATCGGCTGAGGTCGGGGTAGAAAAATTTGAGCGAAGGTCTCTGCGTGGCGCGAGAAAATCGCCAAGTAGTCCCCGCGCGTCTTGGCTCGTGCAGCCT
TCTTCCGGATAGCAATCTGCTCGGGCGGGTGAATCTCCCAGAGTAATGGATCTGTCTCGCGCAAGTACTGCACACTCCCAAGCTGCTGATACGAAGCCGT
CCAGCGCGCGGTTGTAGTCCGCAGCTCTTCTGCGTCGGCATATTCCACATCCTGCCGTTCTTTTTCAGCTGAAAGCGATAGTGATGAAGACGCCATGGCA
GCTTTCGTTGCTGTTGGGGAACGGAACCGATAGAAAGGCGTCTTGCGCTTCTTGTCAGGTGTCGAAAAGGGCCCAAAAGATGAAGAGGAATGTGCTGGAA
GCGTCGATGAAGACCCAGCCGTGGCAGCTGCTAGCTTGCAGTAGAAAGACGCCCGATTGAGCGCTTCAGCCCAGGCACTTACAGCAGCTTCTGTCTCCTC
AACAACACGCAATTCGATTGATTTTCGCCTACAGACAACAAGGTGAGATCAATGAACGTGGGCTCAATAACAACACGCAACTGAAGTTTCATCATAACGT
ACGGGAACACTTGTTGCGTGAGCCTTGCGGAAAACTTGAGCACCTGTAGCCGACGGTGTGAGCTACCACTAGAAATGCTGAAGGCCATAGCTTGGTCCCC
GCGACCACGCTGAACGAGGGCATGGTCTAGTAATACTGCACCACGCGGGAGCCCATCGGCCTCACTGGCAAAATAATACAGGCGGTTCCCCTTGAGCTCA
AAGTATCGAGGCTGCCATGAGCTACCGAGTCCATGCTGCTTCCGTTTTTTCTTCTTGAGCCAACCCGTCTTTTCCGGGGCAAGGTGGGCCACTGAGTCAG
TGATGCTGTCATCGTCTGCTATAGTAAATTCTCCTTGCAATGACGCGTGCTCCGATGAGCCAGAAGGCTGCGATGATAATGACAACATCGACCACGATAG
AGGCAATGCAGATACCTGTTCACTGCTGCTTCTTCTTCCTCTTCCTCGTCGTCATTTTGCCCTCGGTCGGTTGATTCGTCTTCGTGTCGTTGCAGTTCTG
TATTGGCCCCGATTGTACCAGGCGAGCCTGTGCTGTTGTCGTCATGCTTCTTGTCTGCCATTTGAGCTTGTGAGAGCCGTAAAACGTCGATATCTTCTGC
TACCAACGTGCTGAATGGGCTCGTTTGAATCGTGATCTCTTTGTCGTCGTCACTTTTATCAAGCTGAATCGGCGATAGTGGTTGTGGAAGCGCTGCGAGC
TCTGCGTTTTCGCTATCACCCATGTTGTCAGTTAATGCATCTGCAGCAGATTGGCATAGGAGAGGTGGTGTCTGTGGCTGCGGAACGGGGCCGACAGGCG
CAGAAGTTGAGGAGGCAATCGGCCGGTCATCAGAACGCTTGGAAACGTCAGCTACTGCCTGGTTAATGCGGTGGGCAAGCGTGATATGCTCAGCGTGAAG
CTCTCCCGAACGCGTCAGTGGTAATGATACTGTCACGGCCCAGAGCTGCCGACCAATCCACTGCAGTGACACGTCCGGATTGATAGCACCATTGCCCGCC
GCGGCGCTACGGTTACTACCAGAGACAGAGGTATCAAAGGCCCATTCTGACACCACCCGTGCAACCTTCGAGACAATGGCAGCCCCAGCCTCCATGGTCC
AACACGTAATGCACGCCTTGAAAAAATCATCTTCACGATACCAGCGCTCCACTCGGGCCTGAGGGAGC