Description :
From Genome Similarity Track
Location :
contig_2:557330- 558392
Transcript NameFunction/comments
g571.t1putative mitochondrial protein, partial

Sequence
1062 bases(100 bases per row)
TTTCCAACACTCCTCCTCGGCCGTCACCTACGTCAACTTGACGATTTGGCGCAACTCCGCCATCCTGGGCGCCGGGAAGGCCTTGGTCAACAGATCCGCC
TTCATCAGATGCGATTCGACGTACTTGGGCTCCACGATGCCCTTGCGCGCGTAGTCGCAGATGAACTTGATCCGGATACCGACGTGCTTGGCGCTCACCA
TGCTGTCCTCGGACTCCAGCTGCTTGATGGCGGCCTGGTTGTCCATGTGCATGGGCATGGGCTGAGAGACGGCAAAGTGTAGCTCGCGCACCAGCTCACG
TAGTCCGAGCAACTCGCGTCCGACGTGGGAGGCCGACGTGAACTCGGCCTCCATCGTTGCCAATGATACGCCCGTCTGCTTCTTGCAGATCCAGTGCACG
ATCGCTCCATCCATGGTGACCACGCCCCCGGTCACCGACTTCCGGTCGCCCTTGTCGGCCGCGAAGTCCGCGTCGCTCCAGCTCTCTACCTGAATGCAGC
GCCCGTCGGCCACGCCGACGTCCATGCGGAGCTTGAGGGTCTTGGTGGCCTTCAAGTACCGTGCGATCCTCTTCGCGAGCTTCCAGTCGCTCGTCCGCGG
CTGGTGCGTGTACCTGGTCGCCTTGTGCACCGCGAAGCTGATGTCAGGCCTGGTGCACCGGGCGATCCAGAGCAAGCTGCCGACCAGCGACTGGAAGGTC
CGAATCGTGGGTTCGCCGTTGGAGCCGACGCCCTGCAGCAGCTGCAGCTCTTGGGGCTCAGCGTCGTTGGCCTCTTCGCCGATGGGCGTCTTGACGCCGT
TCGCATCCGCCAGACCGAACTGCACCAGCAGCTCTTCAATGGCGGCTTGTTGGTCTAGGTTGTAGCCGCCCGCCTCGTCGAGATGCACGCGCATCCCAAT
GAACTTGCTCCCCTTGCCCAAATCCTTGATGGACAGGATCTTCATGGCCACAAAGAAATCCTCGATCAGGTCCGGCTTGGACGCGGTGACCAGCAGGTCA
TCCACGTACAAGCCCACGATGGTCATGTCGTTGCCGTCGCGCTTGTAGTAGAGGCACATGTC