Description :
From Genome Similarity Track
Location :
Scaffold_15:557228- 564902
Sequence
7674 bases(100 bases per row)
GTACCAACCTATAAATACATTCAGTCTTTGATCTACCGCTTTTCAAGTCAAGTCGTCCCCTTCAGACCAGGGACACGTGAACGGCTGTTCACTTGGAGTT
TGTATACTTCTGCTTCCTCTGTTAAGAAGTGCTGTGTGCCCCGTCACACTTGGTAGCACTTGTAGTCAATCCTACGCCTACGCGGGTAGATTGGACTACC
TGAATCCTCTGTGGTCTCATCGAGTGAGCCAAGATGGATCGTACGGAGTTTCCCCATCTGAACGACTCGCAGGACGAGTCCGTTCGTAAGATGGCAGGCA
TCTTTGGGACAGATGCCCTGTGTAGCTTAGCGGCGGCGACGCCGGCTGAGCAGGTTGAGCGTATCAACGCGTTCGACACCTACGAGCGAGGGCTCATCGC
CCACGTTCAAGGGCTGCAGGCCACTGCGGCCGCGCCGAAGCCGGTGCAACCGAAGCCCCTGCGGCTGAAGGTTCACCCCTTCGAAGGGAAGGAAGGAGAA
AACCTTCACTTGTGGGTTCGAGAGGTTGAGCTCGCGATGGACGCGGCTCTCGTCTCGGACGAGCGACTCCGTGTCGCCATTGCGCTCTCCAACCTTAGTG
GTCGCGCTAAGAGTTGGGCGTATACGCGCGATCGACGACGCCTGGATGCTTTGCATCATGGTCCCAGCTGTGCGAGCAGCTGCGGGCCGCGTTTCATCCG
GCGAACTACGAGTACCGCCAGCGTTCGCGCTTCCTCGCCTGCAAACAAGGATGGCGCGAGCTGCATGAGTACATCCAGGAGATGCGAGTGCTCACTGCCT
CTTTGGTGGGGAACCCCCTGCCTGAACACATCAAGGTGACCGTGTTCATGGACGGTCTGCGTGTCGGTCCTGCCCGCACGCAACTGTTCCGTGTGCAAGC
AAACACTATGGAGGAGGCGATTCAGATCGCCCTCCAGGAGGAGTACAGCCACAAGCAGGCTCGTACCCCCGCCACGGTATGGCAGAGCAACCCTGCCTCT
GGCGGTGCGCCTAATGGTAACTCCGGCAATGGAGCGATCAACGGGCCGGTTCCCATGGATCTGGGCATGGCCGAGCAGAGCGACATTCGCTGCTACGGCT
GTGGCAAGCTTGGGCACATGAAACGTGCTTGTCCCGCGGGAAGACTGAAGAAGAAGTTCTCTTCGAAGCCCTTTGGCTCTAGGGGTCGCTGGCAGAAGCC
GCGCCCCAGGAACCAGGAGAACGCCGGACACAAGTAGGGGCAGGGCCCCCTACTGGGGAAACACTAAGTCTTCATGAGGGGCGTGCGGGTGGCGCACGCC
ATGGGGACTTAGCCCCTGAGAGTCTCTGTACTCTCGAAGCGGAGAAGGGCAGCGGTGGGCTACTTGTGGTGCACGCGAGTGTACCGGGATACGATCATCC
CTTGAGAATCTTGATCGACTCTGGGGCGTCCAAGAACTTTGCGCGCCGCCAGACTGTCGCACGCAATCGCGACAAGTACGCCGATGCGCTACGAGGCAGC
AAAGGCAACGGGCTGGTCTCGGTAAGACTGGCCGACGGTACGGTGGTAGAAGTACCTCGGGTCCACATGGACCTCACTGTCAAGTTCGAGGACTTCGACA
GCTGCTGGAGATGGCGCCGCTGGCGTTGGCGTGGGTAACCAAGTTCCACGCGAGGTCACTCAGACCGTAACTGATGAGGAAGGCACTGCAGGCGCTTCCG
AGGTGGGTAACATAGTTCCACAGGAGGTCACTCAGACCATAACTGATGCGGGAGTCGCTGGAAGCGCACCTGGTGTGGGTAACCAAGTTCCACACGGCGA
GGTGGGTAACATAGTTCCACCCAGCAAGGCGGGTAACCAAGTTCCGCTCAAGGACAAGGCGGGTAACGTAGTTCCGCACGAGATCGAGAAGATCGGTGGT
GCCGTCAAGGCGGCGCCACAAGACGAAGACACCCGAGGGTCACGTCGTAAGCCGGGCCAAGTCGTGTTGCCGACGACGCCAGTCGCCAGCGACTCCGAGC
CTCCAGCCAAGGCTCCAGCCGCCGAAGAGTGTTATCACATCTTCGACGGCGTGACCGGTAGTCGGGTCAAGACAGGAGCTGTCGAGCTTACAGCTCTGCC
CGAGGTTTCAGAGTTGCTGAGCCTTGAGGAGCTCGCCATGGAGGACTTCTTGGCCGAGCTAAAGGCCGGGGAGATCGCAGAGTTGGTTCTCCTCCGACCG
GAGTCCACGTCGGCCGAGTTGAACTCATCCTCGGTCATGGACCAGGCAGTCCTGGAGGAGTTCCAGAGACAGCGCGCGTCGCGCATGGGCTCTGAGATTC
TTAAGAACCCCCGGGACCCGGTGTACCCCTAGGTGAAGGAGTTTGAGGACGTGGTGTCCAAGGATCCACCGTCCAATCTCCCTCCGGACAGGGGAATCAG
GCACGAGATCGATCTCGTGCCGGGCACGAAGTACTGCGTCACGAGGCAATGGCCTCTTCCCCGGGAGCAGTGTGAAGTCATTGATGCCTTCTTTGCCGCC
AAGGCGAAGGCAGGCATGGTGCGGGAGTCGAAGTCCCCGCACTCGACGCCTACCTTCTGTGTTCGCAAACCGAACGGAAAGTGGCGTCTGGTTCATGCTT
ATAACAAGCTGAACAGCGCGACAGTGCCTGCGCAGACACCGATCCCGCGCAAGGACGTGTTGCTCAACAACATGGCCGGCTGCACGCTGTATAGCGCGCT
GGACCTGGTGGACGGATACCAGATCCTGATGCGCGAGAGCGACATCCCACTCACGGCTGTGAGCACGCCGAGCGGTATGCTCTGGGAGTGGCTGGTCATG
CCTCAGGGGCTTTCTAACGCCCCGGCAACGTTCAATTGCTTGGTCACACAACTGTTCCGACCTTTGCGTGCGTTCACACAGACGTACTTTGGCGACATCT
TCGTCCACAGCCGTGCCGAGGCAGGCCAGACGGTCATCTGTGTGTTCGCAGCTGAGGAGATCAAGGTCCTGGGCTGCTTCGTCAGCAGCGCCGGGGTCCG
GGCGGACCCGGAGAAGGTGAAAACCATCGCGGCTTGGCCGCCACCTCGGTCGCAGAAGGACCTACGACAGTGGTTGGGCCTCGCCAACTACCTGCACAAG
TATAGTGCAGGCTACGCCAAGCTGGCACGGCCCTTGTCGGATCTCCTGAAGAAGGATGTCGACTGGCGCTGGGAGCGTCGCCATCAAGATGCTTTTAATG
ACATCAAAGCGAGCTTACAGCGCGCGCCAGTCCTGGCATTGCCGGACGAGACGAAGCCTTTCAGCGTAGTCTGTGATGCGCCTGACTACGCAATTGGCTG
TGCGCTATTGCAGGCCGACGATGAAGGCCGCGAACGGGTCATCTCGTTCCAGTCCAGGCAGCTCAAGGCAGCCGAACGGAACTATCCAGTCCACGACAAG
GAGCTACTTGCCATGAAGTACGCTCTTGTCAAGTTCCGAGTGCACCTCCTGGGCTCGACGCCCTTTGTCGTTTATACAGACCACGCGTCCTTGCGGACTG
CCGTCAACACGCCGCATCTCTCACAGCGGATGGCGCGTTGGCTGTCATTCTTCGCGGAATACAACTTCCATGTCGAGTACAAGCCGGGCAAGTTGAACGT
GCTTGCCGACGCGCTGTCGCGCCGACCCGACTACGAGCTTGCTCATATTAGTCGGGTCACGACGGATCTGTATGATCGCATCAGGCTGGGGTACCGAGAC
GATGCCAGTCTCGGACCTCTTGTGCGGTTCTTGGCCGCTGGCTCGGAAGCCAAGGCCGAGTGGCTCACGCCCCGACAACGTGCAAGGCTGCACCGCTATG
AGTGGGCTGACGGTTTGCTCCACTATAGGGTCGAGCCCGAGGATCCTCCCCGTATTGTCGTGCCCAACGACGAGGATCTCAAGTACGACATCCTGATGGA
GGCGCACGACGCTCCATCCGGTGGCCATCTCGGCCGTGAGAAGACGTACGCGTCTGTCTCGCAGATGTTTTGGTGGCGTCACATGTACAAGTGGGTCGCC
ACCTACGTCCGTACGTGCGAGACGTGCCAGCGCGTGAAGCCTGCCGGTCACGCCTCGGCACCATTGCAGAGCCTGCCGGTCCCAGCGGACTGCTGGAAGT
CGATGGGTCTCGACTTTGTCTTCGGACTTCCGGCCGATGACCGTGGCAACACTGGTGTTGTTGCCTTCGTGTGCCGTCTGAGCAAGATGGTCCACTTTGC
TCCAGTTCGTGACACCGTCACTGGCGACGAGGTCGCTCGCCTGTTCATGGACTGTGTCTTCCGACACCACGGTCTGCCCGAGACCATTGTCTCTGATCGA
GACCCGCGGTTCACCGCTACGTTCTGGCAGACGCTGTTTCGCCTTCTCGGCACACGACTGTCGATGTCGACGGCGGACCACCCGCAGACGGATGGCCAGA
CGGAGCGCGTCAATCGCGTGCTCGAAGACACGCTCCGCAGTATCTGCGCGGAGATGCCCCGCTCTTGGGCTGATCGCTTGCCCATGGTTGAGTTCACACT
CAACAATGCGGTACATGTATCGACGGGCTTTACGCCCTTTTACCTGAACGGGTTGCGCCACCCTTAGGTGCCGCTCACATTACGAGGCAGTACCGGGGCT
TCGGTCCTAAGTGGGGGAGAGGCTCGGAAAACCTTTTCCTCCCAAGTCTCGGACGTGAGTCCAGCCACCTTGCGGAAGCAACTGTCCTCGTTTGCCGAAG
ACAGGCTGAACATAATCAGCAGGGTGCGAGACACCATGGCGCAAGCCCAAGATAAACAGAAGGAGTACTCTGACCGAAATGGAAGAGGAAACATGAACGT
GTTTAAGGTTGGGGATTTAGTTCTCCTAGATACTAGAAACCTACCGCTAAACACTGTTAGCTCGGTCGAGAGCAACAAGCTGAAGCACCGCTTCATTGGA
CCCTTCACGGTCCTCAGCCGGCATGGCGCGGCGTACACCATAGACTTGCCCAAGTCGATGACGACTCACCCGACGTTTTACGTGGGTCGTCTTAAGAGGT
ACCATGGCCCTCTGGCTCTGGCTGCCCCGCAGGAAGCGGTGGGTGGCCCGGTGGAGAAGAGCGCAGCGTCGAGTCGCGGTAAGGCGCCTGATACGCGCGC
TGGTCGTAAGACGGCGCGGCGTACATCAGAGCAGCATACGCAGGGGCCCCGTACGAGCCCTGGCCAAACTGGGCCTGATACGAGTGGGGCTGCTGCTGCT
CCGGATACGGCGCGTGGCCATGAAGCTCGGCCCAAAGGCCAGCGAGCTGGTTTCGCAGCGAGTCGTAAGACGACAGGTCGGCTCGACGATCCACACGGCC
ATGGAGACTGCGAGATTCTTGATATAGCGAGGCAACATCCTCACGGAGCCGCTCCACGGCACCAGGCTGACCAGCACGAGCGGCAGCCTTGCCACCAAGG
CCGACGCCAAGCGCGATCTCGAGGACGTACACACGGTCCCGGAGAAGACGAATCTCCACTTGCTGCAGGGCCACCACCTGACTCGGGGCCCCAGCATACG
GCTGCGTCGCCTCAGGATCGTAGCCATGGCCGTGCGAGGCCACCGCCGGCCCTCCTTGATCGTAATGGGCAGATCCACTACCACGTGGAACGAGTCGTCC
GGGAGCGGCGGCTCCATGGCAAACGCCAGCTGCTCGTGAAGTGGAGGGGTTACCCTGAGTCGGATAACTCGTGGGGGCCCGTTGAGCAGCTCCAGGCAGA
CTGCCCGAAGGCTGTTGCGATATGGGACGAGAAGCAGCGGCAGCTTCGTAAGTAGTCCTTGGCTTCTTGGCCGGTACCCGGGGCACGGTAGCAGACGTAG
TCGCACCACGCCCACGCTCTTCACGAGCTTTGGCTCTCGCCTCTTGCTTCAGCTCGTCCATCTTCGAGTGGACTTGCGCTTGCTCACGAGTTGAGCGAAA
TCGATGCGGAGCTCGCGCACGTCCAGGATTGCGGACAGAGTGCGATCCTCACGGAGTTCTTTGAACTCTTGATCGGAATACCCTTTGCGCTGGACGTAGC
GCCAGAAGAGGTCTTCCACCTCGCTCCAGGTCATGTTGTCATTCGGCTTGACCCAGTGGAAACCCCACACAGGATGGAGTCCACCCTTGTCCTCCGGCTT
CTTGCGAAGCGTGGTGAACTCCTTCAGTGTGAGCTTGGGTGGTGCTAGTAGCACACACCGGGCGACTTCAACGTCGCCAAGAAAGAGTGGCTCTTTCTCA
ACAAGAGCACGTTCATAGGAACCCCTCGAGGTGTACCCGCCGATAAGGCCACGAGGAGCCGAGAGCTTCTCCAACAGCGCTGGCGCACCAGTGCCAGGCT
CGGGTGGGAAGTAGCCCTGCGGGTACGTGGCATCCCCGCCTGAAAAAGACTCGATGGCAGTCGTGGCAGTCGGCTGCCTGGCATACGCACCCGAGCTAGC
AGCGTGGTATTGCTGCTGCTGCTCGTCGAGGTTGTTGGAGAGCTCCTTGGGCTCGTGGACGGCACCCTCCTCGTCCTCAGACTCCGAGTCGATGAACAGC
TTGGAGCTGGAGCCGCGAGGCGACCTGGAAGCTGAACGCTTCTTCGCCTTGGCCTCGGCGGCCTTCGCAGCGGCAGCCGCTTTCGACGCTTGGGCACGCT
CACGACATTGTGCCAGCGTCAGATGCTTGGATGCCAGCACCTCCTTGGGCTTGGAGCCCGTGTCGCTCGGCGACTTCTCGGCCACGACCCCAGCGTCGGC
CATGGCGACTTCGTCGTGCGACTGCTTGCTGTCGCCTGAGCCGGGCTCGGCGTCCTCCGCCTCCTTCTCTGACGAGGCCTTTGCGTCGGCCGAGGCGTTG
GTCATGTCGCCCGCCGCCAGCTCCGTGCCTTCGGCAGCGTGCGTGCTGCCCTCCGAGACGTTCTCGTCGTCGGGTGAACTCTCACCGGAGTATTGGACCA
TCGTGCAGTCAAAGACGGCGGCTTCCCAGTCGCGAGCCGGGCTTTTATGTCCCCGAGGACTCTCCTCCTTGCCTTGCGCGGCGTCAGGAGACTTGCTCCG
AGCCCCGGCCTGACGGCCACTCTCCGGCGTGCTGCTACGAGAGCGCACCACCTCCTCGACCGCCTTCGTGGCCTCCATCAGCGCGGACGACTCGTCCTTG
GCCTTGGCTGCCCTGGTCTTCGGCCCTACGGCCCGCGGTTTCGGAGGTGCTTTCGCACTGCGCGCACTGCGCTTTGGAGCCATGCTTCGGTCGACGTGGA
GACCCTGCGGCTTGCTCGGCGATGCGCCAGTTGCTCTGTGAGGCCCGGGAGCCGAGGCGCCAGAACTCGCGCCGTTGTCGATGGATTTCGACTTTGCGAG
TGAAATGTGAGTCGCCGGCGTAATCTCGCTCTGATTGGGCGATAAGATCGAATCTAAGTGGGGGAGGATGTAACGGGGTTACATGGAATAGTGACCCTGT
CACTATTCCGGGATGGCTACATCGGTCACTCCCCTTGATAGTGACCCAAGTGGCCTCAGAGCCAACAGATACATTTTGTATGACACAAACTATAGGGAAC
TTAGGATTTGTATGCAGGCCAAATCTGTACCAACCTATAAATACATTCAGTCTTAGATCTACCGCTTTTCAAGTCAAGTCGTCCCCTTCAGACCAGGGAC
ACGTGAACGGCTGTTCACTTGGAGTTTGTATACTCCTGCTTCCTCTGTTAAGAAGTGCTGTGTGCCCCGTCACA