Description :
From Genome Similarity Track
Location :
Scaffold_1310:5572- 6588
Transcript NameFunction/comments
Phypl_g13074hypothetical protein
Phypl_g13075hypothetical protein PHYSODRAFT_333324
Phypl_g13076hypothetical protein

Sequence
1016 bases(100 bases per row)
GCGGAGCCCGACCAAGGTGGGTGAACGCCTTGGTGGGTGCGGTGAGAGTCGGCAGGGGGGCTGCCGACGGGAGGAatggtggagacgctcgttCTGGGAC
TGGCCGGGGCGAGAAGAGAAATGGTTGAAAGAGGGAAGTCTGGAGGACCGACCAGTTGGTCGAAGATGATACGGTGGAGGGCCGTCTCATAAGAAAAGCG
GGAAAAAAAATGGAAGGAAAGAGAGCCTGCGGAAAGTCAAGCGTCATATATTGGAGCGAGTGAGTGGCGGCTACAACATGCATGCGACGACAGATACCTA
GAGCTCCTCGATGTACTTGCCGGTGAGGCGAGGAAGGGGGTAAGCAGGATGTGCGCGCGTCACGGTGCAACGGCGATTGGCGTCCGTCGGAGTGCGGAAG
AAACGACGCCAAGGTTGCTGAGCATCGATGTCCTCCAACGACGCTTGCAAAGTCGCGTGCTGAGAACCCGGGTACCAACGACCGACGGGCAACCGACGCG
GCGTGAAGTGCAAGAACCacgggtccagcagcaggtcccTGTCCGCGTGACCACGCTGAAAAagctccacgaccagcgacAACACACCGTGCAAATGTTC
GCCAGCGTGCGAACGACGGGAGTTCCGACGTTTCCGCCAGCTGTCCCAATAGGCGCCGCTTggcacgaccagctcgtgcgtCGTCTCCCAGTAGGCCATC
GCCCAGTTGTTGAGGTGCACACGGTGACGAGAGACGAAGGCTGCGAAAGCCGCGCCGCCCGACGCGAACGTGAGCGTCTCCATCGACAGCATCAGATAAG
TCCAAGGCTCCGTAGCATAAAGCGCTTCTACGTTCGCCcgcgtcagcagcgtcggccGGAATGATCCAGCGGCGTGAAGGTAGGAACGTGAGGCGGATGT
CACGGGCTGAGATCGAGGCTAACCGCATGGAGCGGAGCGACTTGGGCCACGGAGCATAGCGCCTTCGTGCCCACTCAGACGGATATTGTACGGGCGGGAT
CGCCGGAGCGAAGAAC