Description :
From Genome Similarity Track
Location :
Scaffold_7:55718- 57177
Transcript NameFunction/comments
Physo_337665elicitin-like protein RAL13A
Physo_519346protein kinase, putative

Sequence
1459 bases(100 bases per row)
GTGCGGACGACTCGAGCGTCTCGAGCTCCAGCATCGTCATCACGACGTTCTGCGGCTCGGCGTGCGCCTCAAAGCTCGAGGAGCTGGCCACTTCGCTGCC
CAATTGCTACTACGGGTACCAGTCTGAAAACCTGAAGGCGGACTTGCTGGAGCAGCTCGATGGATGCTCTGGGGAGGACACTTCCTACGCCATCAACGTC
GTCCTTAACCCAGAGGAGGCGATGGAAGCACCGGCAACCACAACCAGTCCTCCGACGACTACACAAAGCCCTCCATCTACGACGAGTCCACCTGACTCGA
CCACTGCGCCCGACACCAACTCCACCTCGGAGCCGACTCCTGCACCTACCGAAGGTGACTCGGGGGCTTACTGCTGAATGGGCTCTGCCCCCTTCAAGCG
GGCCCTGCTCTCTCAAAAGCTACCTACGCTCGTAGTTATCAATTCTACTCTTTCATATCAGCATCAAACAACCGAGAGAGACCCCTGTGCGTATCACAAT
TCCATGGGATTTACAAACAAAATCGACGCTACCTGCTTACAATTATACCAGCTTCTTGATCGTCCGTAGTGCGTACACCAGCTCCGACGCGGCAGGACGC
ACGCGCGGATTCTTGGCGAGACAGGAATCGGCCAGCGACCTCAAATCTGACGGGCAGTCCTCACCGAACCTGAGGCGGATGGAGCCTGCAGCGATCATCT
GAAGCACCACCGCCTCGGCCAACTGAGTGCCGCTCAGACTTCGAGCGTCATTGTAGGGCGGCGCATGGGTGTCCAGCTCGGACAGCAGCACGCCAAAGCT
GAAGATGTCGACTGCCGGGTCACGGTCGTCTGAGCCCATCAAGACTTCCGGCGCTTGCCACGGACCCATAACACTTTGCTGGTCCTTGTCGCCGCTAGCA
AGCGCCCTCAGATGGGATACGCCGACCTTGCTCACTTTGGCCTTCATCTCGCTAGTAAGCAGCACGTTGCTCGCCCTCAGATCTCGGTGCAGCACAGGAG
GCGCGAACGAGTGAAGGTAGACCAGAGCTTCCGCCACCTCCAAGGCGATCTGCAGCTTTTGTTGGGTCCACTCACGCAGCGTACCGGGTCTGGTCAGGTA
GTCGGTCACGTTTCCGTTGTCCACGTACTCGTACAGAGCTTGGATGTCGGTCTTGACTGTCCACGCGATTCCGACGAGCTTCACCACACTTGGGTGGTCC
AGCGGAGCGGCCAGCTTGATCTCTTCGATGAAGGCCTTGGTGATTCGTCGACGGGCCAAGTCCTTCCGAAGGCGCTTTGAGGCCAACAACTGCGACTTGC
GGTATCTGACGAGCCACACGACACAGTGGCCACCAGCACCGATCTTCTTGACGTTCTTGATGTCCCCCGGCTTCAACATGAGGGGCACGAGTTGCGGGTC
GTCCAGCTCCGCCGTGATGAACTTCACAGCCCGGCGACGTCGACGGCATACGCAGATCA