Description :
From Genome Similarity Track
Location :
Scaffold_72:55707- 59365
Transcript NameFunction/comments
Phyca_LT1534127904DiNacetylchitobiase putative
Phyca_LT1534127785conserved unknown protein

Sequence
3658 bases(100 bases per row)
gctcagtgtagtcgagtgtgtctgcgttccacataccaacaccgcgtagtccaagttcgcgcacgagtgcgtacttaagccggaggctgcgtgagttgtc
gaaccaaatctgtgaccgtccgccctccggtggcgagtaccacacgaacgggctcagtgttgtggagtcccattgctcgcggagaccgtggctcttcacc
agtcgccggatgtcgccgtagtcgacctgtccaccggccgcgtcactgcagggggcgtcgaagaagggcactggccgcatctggcaccactctgcctgct
ggtcctcgcactggtaacggtagccataccaaggtacgcccagcaccagcttctctggtgcaatgccaaacccgagcaaaaactcctgcagcccttgctt
caccaatgctaagggagagttagcgcctgcaatgcacgtgtcgtacacttgactacgcatgtcgtacgacatggcgaacagaaagtctgtggaggcagcg
agctcgcgccacgggtagtagcgaccatcaacgcctcgaggcgcccagggaacgtcaaacgtgatctgcaacaacaaatttaaaaaagatcagcagttga
aatgcagttatacatgtcatagtgacgacaacgcacctgcgcgttctgagtgagagcatgctgctctagctcatgacgcatctcacggacgagcgaggca
aggcactgcgacgtggccccgtacatgggcttctctgtgtcgatgttgactccatccgcatagttctccacgatctttaagtaagttgcctacagcacga
gacaataataaaatcaataaaagaggccaaattttagattgttgtccctacctcgatccatttctggcgtgcagtggcgttacacagttgatccacgtcg
tcaaaattgtgcttcactacgaccttcacgcctttactgtgtgcgtgacagagtagctccttgtcctcgttccaggccaccgtcgtgagctggggaacac
tcagcacttagtaccgctttgtatctagaaagacccatttcactacactacctggtcccagtcgtagtgcttccagcggtcgtctgtcgccacagagaag
gcgaacacttccttccggggcttcttaccagtaaagtcaatgggcaaacacagcgaccccgagctggcattaaggagctcgtcacatggacagttgtgta
gacgagcgcggtcctcctgagtcaggcggtcggcgaagagtcccttcgcgtcatacaccgggatggagcgagaggcgcattccctcgctacgatgaccaa
cagcagggcaacaagcagtcgtgggggaagccactgcatcatgcagtcttctttctgatgatactggcacagtgtaccacttaaaaagatcgtgtccctt
cgtgcgcagaaagtatctttcggtggtcgacttccgcgcctcctcgtgcgcataacaacagtaagaagaagagaagaccatggctcgatctagcagcgcg
ctcatgatgagcatggggactgttagcatgtgggggttttcacccgcgtacgacgtgtgcagcggcttttcggcgtggaacaagagcgagaacagaaaca
ttgctacttcgaccggggtgggtgctgggaatgaggagaagatgcctgcagggcctatcaacgtgttgctagtggggcctggggacgtgcgtcatgtact
ggcgactatcgcgcgacggcgacgatgggaagtacaccgaccagtgcacatttacatcttcgaaagagctatcgaggccctggcccgagacttgctgctc
cttcaagttgcactcgatgcagatgtaccgctccgccaacgatgcaacttgtttttggagatatttggaaacactcgggtgcaggtacgctgacagagat
acacagaaatattcgtgaaaagtttgactaacgtttttttttcatcaaggagagaacaagcgcctacattgaagagcaggcgaagatgctagtggattta
atctacaacgaacgtggcccactggcagacctcgttgatttatctcatttaaagatgcgcactcacgacgacctcatcgattcgttccgaagctggttcc
agagtgttcagtttgacggtaagactgaacttgacatggcctgggagcttacaaccactaattacctggctgatgtgcacgtgaagttgacacacttcgt
gatcaccgtcttcgtcactactatgaagtccgttacgactaccgtgacaacctcattgattgggattacaccgtaagcccccaaactttagcttacgcct
aaaatcataactcaaggtgttttctatccaacagatgaagctcaagaagatagagaacgccagtgtgattcatattcgccagtatcgaaattggagaagc
tcgggggtggcgtttgaattcggagatcaaacgtacacagttcctaatcggacaatggcagcatacacggaggtacaagtgtttgcactgaagtaagatt
ggacgggaaatgcttactttgtatcgacgccacctttcacaatgacaggcgaagaagaagcaccatgggtctgtgttgtgtagaggcttgtggacagata
tcatactgagcccttacatttcgttcggtgttcattccgaaatgtgcaacaaatttgtggagctgctctttgagatccacaacaagggcacgggtgtgga
acagaaccgccatgtacgtacttactttattatgatggtattgattttgtattaagcggagccatttcaacagaacaccgtcgaaattgctgtttataac
gtgctttcgtatctgtacgagatcgagacgggcaccaagtaccagatggaaaaggtgaagctctactttctgaaacctttgcgtttattctattgcctca
cgttgcagattcgctccaggagcacgacattttcagcggaatcggagatgtagatgatagtaacaaccagtcaaaagaagacgagccgacactacgattc
gaagagctggacgagaacacagagcagctcaatacaaccgaaaggtatgcagcaagtacttttcattatgttgatgaaattattcccactggtgttgtct
tggacaagggaaacccacaagcaagaagcagctgcagctaaagctaagcgacgggctgaaatgattaaggaatctttgaaaggcgttaaggtaacacttt
tgctaacagaatgtcggatagtgaggttttagtagctgaaaatgtgtttttgcagattgtgccattgacaggcaagatagaggatattttctccaagaaa
cgctactccagtctgttcgactacgtctttgtttcctcgcagcaatgtcacgtactccaaccctctgaagacgtcgagcagcaagcgactgcaaaattta
cacgcattttgaaggagggtgcgaccgtagacatcgagtcttctgtgtaagtattacggttggcgtatacatgcaaactctaatatgaactgggcgcagg
ttcatgcttcctcttcaagagcagcaacgggtgctttacgtgaccaaactcgaggaatggactgcacatcattcactgcaacctacgtttaccttcggtg
acaaaaaggagccctccaatgacgatatgaccaagatcaagaatgccgttctgcgatt