Description :
From Genome Similarity Track
Location :
Scaffold_309:5570- 10810
Transcript NameFunction/comments
Phypl_g6783nardilysin, putative
Phypl_g6784hypothetical protein PHYSODRAFT_313258

Sequence
5240 bases(100 bases per row)
CACAGCGTATGCGACCGCGGGAATGGGAACTGGAAATGGGCGGGGCCCAATTAAAGTGGGGCTTCCGTTCGCCTTTTAGTTTAGTCGGAACGGGTGTTAT
CCGTGGTGGACATAATTCCGGTCAGGACATAATTCCGGTCACCTGCCTCACATACAAATCTAAGTCAAAACGGAAAAGGTGACCCTGATTTGTGCCGCCA
ATAACGACGTAAAAACAGCCTCTGCCGGCCTGTTTGGGGCATCAAAACGAATGGCGGGAAACTCCTCTTTCAAATAAGGTGCTGCATTGTTGGTTTTACT
CGTGGTTATTGAAGGTATCCGTCGACGGTCACTACTGCTGGAGCGGGAGATGCAATTTCAGCCCCACTGCGGTACACTTCAACGCTGAGCTAAATACAGA
AGTCCGCGCGCTCGAAGGTATGTTCAGAATGAGGTGAACTCTGGTCATTCCAACCACTGTATTATGTGTTGTTTGTTGTGCAGTGGGGGATGCGGACAAG
TTCCTGGACGCCTTCTTCTTTGACACCTTCGTCAACGTGGACACTGACCGGACGACCAAATCCGTCTTGGTCGATGAAAGCAAGGTGGTGAAGATCAAAC
TTTCGATTATTCACCTCCATGAAGAAAAGCTCAAGAAAGCCACCGAAAgggccaagaagaaggccgatGAGGCTGCGGGGGTGACTGTGACTGCAGGAAA
ACGCAAACAGGGGGATGCCAGTCGTTTTCAGAGTCAGTGAGTGTTAGTTGTTAGTTTAGTTGTATGCCTTTAGTTGCTATGCCGATCACATAATACAAGT
AGATCGACTTCAAAGAAAAACACATTGGTTTCGTCCATTCGATCAGCGAACTCCTTCACTTGGTTTCAGTATACTTCCTTGGGTTTTGCAGCTGGTTTGC
TGCTCACAATCCGATGGCGGACCCCGTGGAGGCTTCCAAGTCGCCCAATGACCAGAAGAAGTACcggctgctgacgctgcccaacgcgctgcaggcgctg
ctcatcTCCACagcggaggtggcgcacgtggtggaggccgtggcgcgcgagagcgagagcgcgGGCCGCGACGAGGATGAGGACATGGACGACCAGAATC
TTAGCGGAGaggacagcgccagcgacttgagcgagagcgaggacgacggcagcagcttcggcgacagcgacgaggagctcgagggcgcgcccagccgccg
cgccgGCGCCTGCCTCACCGTGGGCGTGGGCAGCTTCGCGGAGCCCGAGGCGCTCCCCGGCCTGGCGCACTACCTGGAGCACATGCTGTTCATGGGCAGC
GACAAGTACCcggacgagaacgagttcgaggccTTTCTGAGCGCCCACGGGGGCTACAGCAACGGCGCCACGGACAACGAGGTGACCAGCTACACGTTCG
AGGTGGGGCCGGCGCACCTGGAGCCAGCGCTCGACATGTTCGCgcacttcttcatctcgccaCTGCTCAAGGCTGAGGCCATGGAGAGGGAGCTGTCGGC
TATTGAGTCCGAGTTCAGTCAGGCTACCCAGAACGACCGGATCCGctcgcagcaggtgctgtGCGACGTGACGCCTCCGAGCCACCCGTACCACCGCTTC
AGCTGGGGCAACAAGAAGAgtctgcaggagctgccggGGAAGACGGGCGTCGACGTGCGCAAGCAGATCCTGCAGTTCTACGAGAAGTACTACTCGGCCA
GCATCATGAAGCTTGTTGTTTGCGGGGAAAACACGCTGGATGAGTTGGAGCAGTGGGTGACCAAGTCGTTCAGCTCGATTCCGAACAAGCAGGTGGAGGT
GCCGTCTTTCGCGTTGGCGGGGCCGCCCTTTGGAGCGAAAGGTTCTGGTGCACCGTTCCTCTGCAAGATTTCCCCTGTCCGGGACATCCACACGCTTCAT
CTCGACTGGATGATCCCGCCCGTTCTTGGTCAACATCACCAGAAACCCGCGGACTACATCGCTAGCCTCCTTGGTCATGAAAGCGAAGGATCTGTGCTCT
CCCATGTATGCCAACCAACTTGATTCTTGTCGAATTGCCAGTTTTGTTGAGAACTAATACTCACGGTGCATGTTGAATGTattgcagctgaaggagcggG
GCTGGATCTCTGCGGTGACCGCAGGGGTAACCGACACTGATGGCTATGACTGTGGTACCTATGCAGCGAAGTTTGATATCACGATGAAACTCACGCTGGA
GGGCATTTCCCACTGGGAGGAAATTGTGCACGCAGTTTTTGAGTACCTGCACATGCTCAGGGTAAATGGATGCCCGGAGTGGGTGTttgacgagctggcg
gcacTGGCCGACATTTCGTTCCGCTTCCAGGAAGAGGATAGTGCTGTCGAAAGGTGTGAAGAGCTGGGAGAAATTATGCAGGTAAGCACTCTTGCTACAC
CAGTTGCAAGATGTTTTTcttttgttgttgttttgAACTAACCATTTTTAAATGCATACAGTTGATGTTCAAGGTCGCACCGGAGGATATTTTGCGCTAC
GACCTGTTCCAGGGTGCCTTCCAGAAGGAGCTTGCTGAAGAAGTGCTGAGTCACTTGGCCGCTGAGTCTGTGTGCGTCTCGATCGTTTCGCAGAAGTTTG
AAGAATCCCCTGAATTTCAGGCACAGGTGTGTAATGATACGATGGTCTCTGCTGATTCAACCTCTTTGAAATTGCTAACCCGTTATGTTTCGTCTTGTTT
TATGGTAATAATAGGCCCTTGAGGAGGAGTGGTTTGGAGTCAAGTACTCGCGAGAGAATATTACGGACATCACTATtcagcgctggaagagcgcaGGAGC
TAACCCCAAGCTGCACCTGCCGCGTCCAAACCAGTTTATTCCGCGAGATTTCTCGCTCGTGGATTCAACAGGTGTTAAGGACCTTGTGTGCGAAAAGACG
GCGTTCGGCAAGCTATGGTACAAGCCAGATCGTGTATTTGCTACTCCTCGCGCTCACGTTGCGCTTTTGGTGCACTTGCCCAGTGTGGTAGCTAACGTGG
ACAATTGGGCCCACACCCAGCTGTACGTGAAGCTTGTTCGGGATGCGCTTAATGAGTACGCATACCATGCGAATGTGGCCGAGCTCATGTACTCGCTTCA
TGTCAAGGAGTCTGGTCTGGAATTGATCTTTGGTGGTTTCAACGATaagctccaccttcttgtcgAAGTGGTGGTCGCGGCTGTGTTTGGAACGGAAGTC
AATGAAGCACGTTTTGAAGTGATGCGAGAAGAATTGATGCGCGAATCGAAGAACGCAATCACGAAGGTGGCACAAAAAGCGAAGTACCTTCGGTTGCAAC
TTCTGGAGAAGAACTCGTTTCCGCTGGAGGAACGCTTGGACTCGATCGAGGCTGCCACCGTAGGATCACTCAAAAAGTACGTCTCAAGCCAACTCTGGGC
AAACAAGGCATGGCTTGCCAGTTTTGCGCACGGAAATATTTcccatgcagcagcgtcgcaAATGATCGCCAATGTCgaagcgcagctgcagcgtgtggct
GCACCGCTACAGTTGCGAGACTTTCCCCGACGCCTTATCAATGCCATCCCGCAGACCCCCATGGGCTTTCTGCTGAAGGAGCGCAGCGCAAACAAAACTG
AGACGAACACACAGGTGGAACTCTACTACCAGATCGGTCCGTTGACTCTGCGTAGCCTGGCCTACGCGGACTTGTTGCACCAGTTGATGGAGGAACCATT
ATTTGACACTTTACGCACGAAGCAGGAGCTCGGTTACGATGTCTCTTGCACTGTTCGTGTGACCAACGGCATTTTGGGCTTCGGTGTCATGGTTCAGTCG
TCATTGTTCGCAGCGGAGTACATTTCTGCTTGCGTTGACCGCTTCATGGTTGACTTTGAAGAGGCGATTGAAATGATGGCTGATGAGCACttccacgacc
acgtccaGGCGCAGATCCTTTTAAAACTCGAGCCCGATCACAACCTCTTAGAGACGACGCACCACTGCTGGTACGAGATCACGTCGCGTCGCCTTGCGTT
CGACATGAATGCTCAGCTTgcgaaggagatggagacgctgactAAGAACGAGATGGCGCAGCACTACCGTGAGTGGATTCTTGAGAGCCCCAAGAAGTTG
ATTGTGCACGTGATCGGCCGTGGTAACTCGGCCGAGAAGATAGCGCGCCACAAACGCAAGAACGCCACGAAAGCCGAGCTTGAGGAACTGCGTGCTTTAC
CCCGATCTATTCGAATCCGCGACTTGTACCTGTTCAAGTCTGAGTTGCCTTCCTATTCTGATCccatcgacgagatcaacgTGAGCGAGGCAAGAGAAGA
TGACAAGCGCCTAGAACTATAGAGCGCCGGTTGTTTCGATGTGAAAGAACCGGTGTTGTCTGCAGTACATGCATTTGCCTTTAGCTACTTGCTCTGCTAG
GGCGTCGTAGTGGTTTCACTGAGCGCAACAGACCCGCTGTGTTGGGCTGAACTGTTTTGCGCctgtcagcagcagcgctatCAGACATAATATATTCTGT
AGACAGTCTTGGCAATCGAGAGTTGGCCGTCGTAGAATGCCGTCTCGATCGTGAGTTTGCCGCTGCATGACGATGGACACAACTTATCAGTGAGAAGACT
TGCAGACGCGTGTTTGTTGAGTCGTACCTCATCATCTCCGGGTCGAGCATATTTTCCGGGCCGGCTGATTCGATGGTCTGCTGCCAAGAATTAGTTGACC
CCGGGATGACGAAGCCGAAGTTGAAAATCCATTCTGTCGTAAAGCAGGCAGGTCATTGCACAAAGTAAGTTTCTTGTTGGTACACAGATAAAGGGGGAGC
AAAGTCGCACCTTCGATGCAGCTTCCTTCTAGGAAGACACGCTGCTCCAGTCGAAACTGCGAAATCTCTTCAACAGAGCTGAAGTTGATCTCGCGAGACA
CAGCAGAGCACTTCAGAATGTCCACAGGAAGACGCGCTACTCTCAACAAGCAAGTAAAAAATGACGCCATCCAAGATTGTGTTAGCCCCAAAGCGGGTGG
CCGCCTTCAGTACGAAACATACaaactacttcgaagtacctTTTTGCTCGACACGGTAGATGTCCTCACCCCTGTCACCCACCAGCAACGTCAGTCTCAT
GATGAGCACATTGCTGGATGCCTACTGTAGCTATTTGGCCGTATCATACCATTCATCCGATTGCCACATCAGTCGACCCGTATCGGCGCAACGCATGTTC
ATGTGGTTACTGCCAGCACAGTGGTAAAGCAGTTTAGAGA