Description :
From Genome Similarity Track
Location :
Scaffold_800:557- 4672
Sequence
4115 bases(100 bases per row)
AACACTGGCGAGAGACAGGGGTGGTGGTCGGCCAAGAAATTTAACCGAAGGATCACAATGAGAGCTCTGGTGCAAGGCGCTGTGAACGACCAGCGAACGA
GGATCCTCCTCGACACAGGAGCGAGCGTTAGTGTGATCACTGACGCCTTTGCCAAGAAGTTGCGACTCCGAGATGTACCCGATCACGGACGCCGCATTGA
CATTCAAGGTATTAACGAAGGCAAGGTGTCTACGACGCTTGCCGGAGTAGTACTAGGTCGTCGTGCTTACGCGGCGAGTGTGCGTCAAGATTACGCTTGG
ATGGGAGATGGTGTACGAGTTCGAGATGTGGGTAATGGCGCATAGTGCAGGCGTCGACGTACTCGGGGCCGACTTTATGATCCCAGCTGGGATCCGGTTG
GACCTGTTTCATGGCGCGGCGCAATTACCGCACGAAGTTCAAATCCCACTGATCAAGACCAAGAACATGATCGACAGCAAAGAATACGGCTCCCATGTTA
ACGCCGGGCCACCCGAGCGTTTGGACATTCAAGCGCACGAGTGGCGAGAATATCGACTAGCGAAGCTCTAAGTCGGGCTGGAGAACACGTACTGTGGGTT
CGTCGAACGAACAAGCCAATCCCGTCAGTAGCGAGGTTTCGGCGTGGACGGCCTCAGAGCATTCGGTTGACCAACGTGTCTGATCGAACTGTGTACCTAC
CAGCACACGACTCGATCGCGATGTGGATTCCAGATGGGGATTTGCCACGAGGTGACGGCTATGTGCGTTTGGATTCAAAGAAGTACCAAGATTGGCAAGT
GTTGGCCTACTAAGGTTGCAGAGACCGCGAGCTCTTTCAGCGTGAATGTGAAATCTACGAGCAATGGCTTGCAACTCAGTCTTCGGCAGTTAAGCGACCG
GACTATCCAGAACCCAGTGAGGTGCTAGCACGACCTCTAGAAGACTCGCCAGTGAACTCTAGTGATCGTCGGACGTGTGCAAAACGCTGGGCACTGATCA
TGGAGGAACGTGAACGAGTAGAGGCCTGTCTGGTGTCTGGGGTGACAGCCGGGGACTCGGCCGACGGTCAACCTTCCGAAGAACCTTTGGACACTTACAC
GACAGCTCACGGCGGGGGGCAATATTGCAAACGAAGCCTCGGTAGCGCGTACACACGAACTACTGAGCCCGGTAAACGTTGTACATACACCAACGAGTGT
TCGTGTCAAGTCTGGGGTGACCACGGAAGCGATAAGTAACAGCACTTGGATATAATGGAGTCACCAGTTTTGACGAAGTTGTCCCGGCCTTGTATGCCAC
CAAATCTGCGAACGAGACATCGGTGGTTGATCCTGAGGATGCAGGCATCGCGCTGAAGGTGTTGAGTACGGCACCGAGTGTTCATCGCGAGAATGGTGCG
AATGCCGAGCTGTCAAGACAACGGCCGATCGAGGCACTCGACAAAAGTCAACAGCCCAATATGGCGGTTGCCTGCGCATTCAATATTGCGAACAACGACT
CGGCAGGTGGCCCAGAGATGAGAAACCAGGATGTGAAGGAGATGGACCCAGTACCGACTGTTGAAATCAAAGCGGATGCCGATGTTGAGTCAAGGGAAGA
ATCCGTAGCTACTTTGGACGAAACGTACATCTCGGTTGCTCGGGTATTAACGACCAAAGGAAATGAAGCAACGGAAGATACGAGAAATGACTTCTACGAG
CACCCAGCTAACAACATTGACTTGGAAGACTACGCGAAGGAACTGGCATTCCTGCCGGACCCGACCAAAGAGATCAACACGACGATAGACTACACTGCGT
CTAATGTTGCTGATCCTCACCTGTCGACTGATCGCCGAGAACGTCTGGTCGCGACGCTCAAGAAACACGAGCACATCCTGATTGCTAGTGGTAACGCACT
GCCGCCGCCAGCCTACGGAGCGGTATGCGATATCGACACACAAGGGCACGCCCCAATTAAACAGCGTGCCCGGCGCGTGCCGCTACAATTTCTCGGCAAA
CTGTACGAGCTGCTGCGCGCTTTGTTGCGAGCAGGACTGATCGTCTTTTCAGATAGCCCATGGGCATCGCCGATCGTGATTGTGATGAAACAGAATGGGC
TAAACATTTGGCTCTGCATTGATTACAAGATGGTGAATGCTATCACCGCGATCATGGAGTATGCAATGCCGCTAGTCAACGACCTGTTAACCGATCTCAA
ACGCTACCTATGGTTCTGCTCGCTGGATGCAGCAAGCGGCTTCTGGGCGGTCATGATGACCTTGCGAGCACGTAGTGTCGGCGTTTGTCTGCGCACTCGG
ACACTTCGAGTGGTTGCGCATGCCCTTTGGATTAAAAAACGCGCCGATGATCTACCAGCGTATGATTGACAACGCACTCTGGGGGTTCGTTCTAAAGGAG
GTTGGTTTGAATACTTGGAGAAGATGCGTTTAGCTGAAGAACAAGCCAAGGAACGTCGTGGGCCAAGTGCCGAGGATTCGTTTTAAACGAAGTTCGCGGC
AGACCGCGAAGCACCGGTGGAGGCCGACCCTGTACTACAACTCGTCAACAGCCCCGTCGCTGACATGTTTACGAACGGGGAACCGGACGAATCATCGCTG
GTACCTGTGTTTGGTCGACGGTCGTTTGTGGATGACATCTGCTTCGGTGGCGAGGATTTCGACAGCTGCCTGGCGACGCTGGACCGATTGCTGGCAAGAT
TTGCACAGTGTCGGATCAGTATTAGCTTTACCAAGAGCATCTTCTGCCAGCCCAAGGTGGACTTTCTATCGCATAAAATTTCGCCAGAAGATATCAGGGC
TGACCCCAAGAAGCTTGCGGCCATCACCGCGCTTTCGTTTCCAACGAGTAAGAAGGGCATGCAGTCGTTTCTTGGAGCGGTTAATTACTACAGCCGCTTC
ATTCAAGACTTCACGGTCTACGGTGCGGCGCTGTACCAGCTCAAGGATGACGACTTTGCCGCTGAGGAGGCCTTTCTGTGGCACGTCGTTCCTTCGAAAA
CTTGAAGACGAGTGTTGCACATTCACCCATCCTCAGGCACTTCGATCGGTCGAAAGGTCGATCGCAATACCTCCAGGTCACGAACGTCAGCGACAAGAGA
TTATTACTGGACCCTTATGAGGAGATCGGGCGATGGTTGGCGAAGGACGGTATCCCTAGACGACCTGGATATGTGTCAGTGGGATCCCGCCGCTACAAAG
AATGGCAGAATCTGGTGTACGAGGCGACTACCGAGATCGAATCTCTCGCAGAGGTGGAGCTCCCAGCGGAGCCAACTGGCCCCTTGGTGGATCGGCCTTC
ATATCCAACTCCGCGAAAGATCCTGCAGAGGGATCGACGGGTTGAGATCCAAGCAATGGAAGTTGGATCCAGGACGGGGGACGATCCCCAGAATCGGCCC
TCAGATAACGCAGGGTCGGTGGATGAAGGATTGCAGAGGGCTAAAGCCGAGCAGCCGGATCCCGCTGATCCACAAGTGGATCCAAGCTCTCCATTGGATA
AAGTGCCTGGATCCCTATCGAGAGTGGCAACACTAGTCACACCCGAACTGTCGGGCTTAAACTCGTTAGAGGACCAACTGGATCCAACTGGTGGTTTCCC
TGATACCAGGGTACCTGAACCCCCGAAGATAGAAGGACTGCCAGGCGAGAGAGGGCCGCGGTGTTTGGATCCAATGGTGGATCCTACGAAGACGGAAGAT
GAGCAAGTCTGTTACCGTGAAGGCGGGAATCTACACGCCGAGGATCTGGGAGAAGGCATGGCGGTGATCCCGGAGGTACCACTGACCACAGAAGAAGTCA
CGATTGATGATATCCAAGTGGATCCGGGGGCGAATGAACCTGCTGAAGTGGATCGTCTGCGTCAGAAAATCTGGGAGAGCCGACATCTGCTGATTGGTAA
AGGTAATGCGTTACCGCCCGCTGCCCGCGGAGTCAAATGTGACATCGATGTCGGCGACGCGAAACCGATCGCTCAGAGGGTGCGGAAGGTGGCACCTCAG
TTCCGGGAAAAACTATCGGACCTGATTAAGGGCCTGCTGCAAGCCAAGATCATCAGTTTCTCGACGTCCCCGTGGGCATCCCCAGTGGTAATCATCATCA
AGAAGAACGGGGTGG