Description :
From Genome Similarity Track
Location :
Scaffold_312:5568- 7945
Sequence
2377 bases(100 bases per row)
ATATATTCTGCATTAAGAAAACAAATGATAATTAGTAAACTGCATAATTCAGGTTATACAACTTTGTGAACCAAAAAAAAATCACGTAGCGAATGCAGTA
CGCGGTGGCTGCACAGCAAAGCATAAAGAGCTTTGTGCCCCACTGGTGGGGGCTTATACTTCATGTACACGCGTATCTTGTTGAACGATGAGCGGCTTGG
TAACACGGCTTCATCAAACGACAAGTATGGTGGCGCTACGAACCCACATGCAAATGTTCTTTGAAGCACCTCCACCACCTTCCTTATCTTCCATGCACGA
TCGGTTTGTGCTCGAGGGTCTTGATTCGAGTTGAAATGCAAGGTTCTGGATATCTCCATGAACAGATCTCTTGGGAGCACCGAGCCAAAACATCCTCGCG
ATATCGCACCAACATCAGTAGTCTTCCAGTGGTTGTTCAGCTTCTTGCGGCTTGGAGCTTTCGTTCTGGCAATCAGCAAACCAATGAATCGACACAATTC
GTGAGGTATGATAGGCTTCATTGTTTCTAGCTCGTTCTAAATGTCTCGACGGGTCTTGCGGGGCAAATCGGGGTTGCGGCGTTGCTTCTTCCGATAACGT
GGGTAAGCTGCGTCAATCCGCAATGATAGCATCTCGCGGTGGTAGTCATTCGAACATCCGGCAATGTGTTGCCACAAAACCACCGGCAAAAAGTAGAAAA
ATAGTGCAAATGGAGAGTCACCATGGAGCAGAGCCTCCGCAGATGGACCAGAATAACCTTGTCTTAGACCTGGATAGCTGCCNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN