Description :
From Genome Similarity Track
Location :
Scaffold_353:5566- 19654
Transcript NameFunction/comments
Pytve_DAOMBR484maker-pve_contig_353-snap-gene-0.12Voltage-gated Ion Channel (VIC) Superfamily
Pytve_DAOMBR484maker-pve_contig_353-fgenesh-gene-0.6Voltage-gated Ion Channel (VIC) Superfamily
Pytve_DAOMBR484maker-pve_contig_353-fgenesh-gene-0.7Pseudouridylate synthase
Pytve_DAOMBR484fgenesh_masked-pve_contig_353-abinit-gene-0.41Mitochondrial Processing Peptidase alpha subunit

Sequence
14088 bases(100 bases per row)
ACGCGAGCACGGTCGGGCTCGTCCGAGCTGTTCCTGCTGGGCGAGGTCCGCAGCGCGTTCGACCCCAACTCGCTCGGCATCCAGCGCTGGCTGCACGTGC
GGCTGCTTGCTATCCTCTATGAGGTGCTCGTCGTGCCCTACCTGTCCGTCTTCCACGCGCACGAGTCGGCGCCGCACACGCGTCGGTTGCTGGCCGGCGT
CTACGCGTGCGAGCTGCTCTTCGTGGTCGACATGTACGTGCAGCTCAACATGGGCTACTACGAGGATGGCAACATGGTGCGCGACTCGCGACGTTCGCGG
CTCAAGTACCTGCGCTCACCAGCGTTCGTGCTTGACCTGGTGGCGCTGCCGCCGCCATCGCTGTTCGTCACGACCCACGCGACACCGCTCGCGCTGCTCG
AGCTGCATAAGCTCGTCCGGGTCTGGCGACTACCCGAGCTCATCTCGAACCTCGACAACCTCTACGCGCGCTCCTTCGCGCTGCTCAAGCTGGCCAAGGT
GCTCGGGCTCACCGTCGTGCTGTCACATTTCGTGGCGTGCGGCCGCTTTGCCTTCGGCACGGGGACGCACGAGACCGACCCGTGGCTGCAGCAGGTGCAC
GAGAGCGAGGGTGATGATAGTCACGCCGACGGCCACGACAGTCGCGGACCGTGGACCAAGTACCTGAGCGCCGTCTTCTGGGCCTTCGGACTGCTCACAG
GTCTCTTCGAGGGCGAACTGCCGCAAACCACGGCTGCGTTCGCCTTCACCATCCTCGTGGCGTTTGGTGGCTTCTCGCTCTTCACCTACCTCTGCGCGAC
CTTCTTCCTGCTCTCCAAATGCGAGTCGGGCGAGTCGGAGACGGCCGAGGCGCGCGTCAACCAGCTCAAGCACCTGCTTGCGTTCCACCGCGTGCCGGAC
GAGCTGCAGGCGCGCGCCGTCGAATACCTCAAGCGGTACCACACGCAGGCCGATGCGAATGATCGCCTGGCTGCCAAGCTGCTCTGTCCATCCATCGCCA
TCGACATCCAGATTGAGCTGCTGCGCGACGCCGTGGCGCGCATCCCGGTTTTCGCCGGCTGTGACCTGCGCTTCATGAAGGCCGTCACGGGACTGCTCGA
GCTCGTGTCGTTCCCGGCGCACCACACGCTCTTCCGCGCCGGCGACCGCGGCGATGCCATGTACGTCGTGCACTCGGGCGTGCTGCACACGGTCATCAAC
GGCGTCAAGGTGCGCGAGCTGCGCAAGGGCAGCTTCTTCGGCGAGGTGGCCGTATTCGCTCACCTGCCGCGCTCCGCGGCCATGGTCACCACCACCTACT
GCACGCTCTACCGGCTCTCGAGCTTCCACGCCGACAAGCTGCTGGAAGGCTACCCACGATGCGCAAAGCAAATCGCCGATACCGTGAATAGCATGTTGGG
ATCAAGTCGGACGCCAGGGGAATCGTCCGCCATCCATACTGACGGCGAGTCCCGAGCGGCGTCCGCGACTGCCTCGGCCACTCGCAGCCGACCCAAGATG
AACCTTTCGTTCCCGCAGCTCGTGCGCCTCAAACAGGCCGTCAAGGCTATCGCCAGGAAGGGTAAGCGCAGGATGGCGATCGTAGAGCCGCTCGCGCAGA
TGGCATCGGTACCGACACCGCCCAGTTCCCCCTCTGCTGCCCGGATCAACTCCACTGCGACGTTGTCGACGACATCCATGAACAGCGAGACGTCGGGTGA
TGCTCCGCCGCCATCAAACGACAAGTTCGCGTCGCGAAGAGAAGAGTTCGAGCGCCAGTGCCGAACCACCAGCAGCTCCAAAGACGTGCGGGTGCGGAGC
GACGGCCGCGAGCACGAGCAGCAGCGCAGCGAGTCCCTCGTCAAGCAGCTGCAGGCACGCCGGCTCTCGCTCAAGGTCTACCCGCTGAGTCCACTATCGG
CGACAGCGACGACGACCACGCCGAGCGAGACGGTGCATCGACCGTCGTTCATCCTCCAGAGCATCCACGCGCTGGCGTTCGTGCGCACGAGCTTCTTCGG
CACACGCAGCCGCGTGGCACCAAAGCAAGGTCCGGACGCTATCCGCGGCTTCTACGACAACATCCAGGCCATCGCCCCGCCGCCAGTACCGCAAACGCAC
TGGTGGAGACGACTGCTGCTGCGCGAGTGCTTCGACGTGAGCACGCGGGGGCGTATGGCGTGGATCGCGGCGCTGCAGCTCGTGTGCTGCTACGACTGGA
TTGTGGTGCCGCTCGAACTCGCCTTCGTGCTCTCCGACAGCCCGCGCGCGTGGGTCATCGACGCTCTCAACGCCACGGCCGACTTGCTGCTTTGGGCCGA
CGTGTACGTGAGCCTCAACCTGGCTTTCAGCGTCAACGCCGAGAAGATCTGGGACACGGTGCGCAGCGCCGAGCGGTACGTGTGGAGCTGGCCGTTTGTG
CTCGACGTGGTCATCGCCTGGCCCTACTGGATCTTCAAGCCGAGCCGCTTCCACCGCCACAGCGGCGGCGTGCTGCGCCTTCCACGGCTTCTGCGAGTGT
GGCGTACGCCAGGCTACTTCGCCGAGGCGCAAGAGTTCTTTCACTTCAACAGTAAGCAGCGGCTGTTGTTCTTCGGACTGCTGCTCGTCATGCTCTACCA
CATCGTGGCGTGCCTGCACTTCAGCGTCACCTTCCTCGAGGGCTTTAGCGAGGAGGAGCGCGCGTGGATCCCGTCCGACGACGTGTTGCTGCACCGCATC
AACGCCAGCTTCTACGAGGACCACACTGGCAACTTGGTGGCTGTCGACAGCGAGCACTTCGCCGCCGTGCGTGCGACGCAGTACTTTCGCTCGCTCTACT
ACGCGGCCAACGTGCTGGCGGCGCTCGGACTGACCATCGAGCCCGCGAGCGACGTGCAGTACGCGATCGCGATCGCCTTCATGCTCTCGGGTTTCGTCAT
CACGGCCATCGTCGTGGACAACGTGCAGAAGTACTTCACGGCGTCGGCGTTCGAGCAGAAGGAGTTCTTCGCCACGCGCACGCGCATCCAGCTCTTCCTC
AAGCGACAGAACGCACCGCTCACCATCCACCAGCGCGTCAATGCCTTTCTCGACTTTTGGTGGTCCGCGCACCGTGGCGCTATCCTCGACGAGATTCTGC
AGGAGCTGCCCGAGACCATCAAGCGCGACATTGTGCGCAGCATCTGCGAGCCAGCCATGGAGTCGCTCGCGCTCATGTACGACCTGCACGACGGCAATGT
GTGTCTCCGGACCCAGTCTTTCGCCGCCCCGCCTGCACCGAAGCGATCAGACAGCGAGACGGATGCGTCGGACCGCGCACAGCTCGAGAACATCGTGCTG
GACAACCTCAAGTTCGTGCTCTACGGCCAGCATGAGGTCATCTACCGCCCGGGCGACTACGCAGCTGGCCTCTACTTCCTGCTCGAAGGCGAGGTCTCGA
TCGTCGTGGACGGCGAAGGCCCTCGCCGCGTGCCGATCGGCGGTTTCTTCGGCTCAGACGCACTGCAGGCGCTGGGAGATAACGCGACTCCAGCCGAATG
CGACGATGACGACGACGACGACGACGACGGATCGCTCAGCTACAGCGAATACGTGTCGGCTGTGAGCGGCTGCATCGTCGTCTTCCTCTCGCGCGAGCAC
TTGAACGGCATGGTGCGGTGCTTTCCCGGTCTCGAGGAATCGCTATGGCGGCTCGAGAAACAGCTGCGCCACGTGACGGTCGCTCGTACGGTGCAGTTCC
GGCTGATGCGTAGCGGCCACATCGCGTTCCCGCCGCCGCCGCTGCGGCGCATGCGGCGCGAGACCGCGCTCGTCACACCACTCGCGCAGCTCCAGCACAA
GTACGCGTTCTGGACACCGGCCATGGCGTTTGACCCTGACGCCGTCGCCATTCGCGCGTGGGACACGTTCGTGTTTCTGCTCTCAGCTGCACAGTGCGCG
CGCGTCATGACCGTCATTTGCCTAGCCATCGAACGAGACGAGCATGAGACCGAGAGCGGGTTCACCCACTCGGACAAAGTGACGCTCGCGCTCGAGCTCG
TCTTCTTCGCCGACATGCTCATCCAGTCGCGCCTCGGGTTCTACGAGTTCGGGAACAAGGTTATGGACCGCGACGCCATTCGCCGACACTACTTTCTCTC
TCGCTCCTTCGTCGTGGACGTCGCGGCGCTGCTGCCGCTGTTCGCGATCAACACGTTCCTCCCGGCGGGCCAACGTGTCGAGGTGCTTAACCTCAACAAG
ATGCTGCGAATGTTCAAGTTCACTCGCCAGTTCCAGTCGCTCTCGACGCGCTTCGTCAAACTCATGGTGGAGATCCGGCTGCTCAAGCTGGCCTTCTACA
CGTTCGTGGCCACGCACATCCTGGGCTGTATCTGGTTCGACTTTGCCGCCAACAACTCGGGCTTCCACTCGGCGCTGCACGTGTCCGCAAGCAGTCACGA
GACGGCAACCATCGACTCGAGCGAGTCCAGCGGTTCGAGCGAGTCGTCCTCGACACTCCTGAGCTTCGGCAGCAACGAGTGGCTGCCACCCGAGGAGCTC
GAACACGCGTCGCCGCTGCTGCAGTACCTGCGGTCGCTCTTCTGGGCGTTCGGGCTCATGTCGGCGTCCAACACGGGTGAGCTGCCCAAGACGGTCTCGC
AGTCCATCTTCAGCGTCATCACCATGACGGTCGGCTTCTTCCTCTTCGCCTACGTCGTGGGCAACTTCTCGGACATCATCGAGCTGCAGGACTCGGAGAA
TCGGCACTTTGTGGCGCAAGTGAGCTCGCTGCGCAAGCTGCTGAGGCACTTCAAGTTGCCCGTGGGGGTCGAGGACAAGTTCAAAAAGTACTTTCTCTTC
AAGCGCTTCCACTCCATCACGCAGGAGCACGTGCTCGAGCGCGTGTTGCCGCCGTCGCTGCTCGTCGACATCCGCCTCTTTCAGCTGCAGCCCATGATCG
TCAAGGTGGCCTTCCTGGCCGGCATGGACGAAGCCGTGACGCGCATGCTCGTGTCGCTCTTCACGCAGGTGCTCTTTGTCAAGGACGAGTACGTGTGTCG
CTTCGGGGAGGAGGGTCGTGAGATGTTTTTCATCTTCACGGGCGTGCTTGACATCTACATCCCGGTGCGCTCAGACGCCGTCACGGTCGCCGCCGCGGCG
CCAGACACGAGCGCGCGAGTCGCGATGGACGGCCCGAGCCCCGAGGTGCTGCGCAAGGTGAACGAGATCACGGCTGGCAGCTACTTTGGCGAGGCAGCTC
TGTTCACCAACACGCCGCGCAACGCGTTTGTCAAGGCCAGCACGTCCTGCATCCTGTACCAACTGTCGCGCCACTCGCTCGAGCTGGTGTTCGAGCGCTA
CCCCGACTGGAAACAGAAGGTGCTGCGCATCGTCAAGATCCAACAGCAGCAGCAGAATCTCGCGCGACTGGCGCAGGAGGCTCAGACTAGCACGGACGGC
GATGATACACCCAGTCAAAGCGGGCGGCGCGCCCGTAGCACTCGCCGCGGTGTGTCGCGCATGGACGCGCTCAACACTCGTGCCGAGGGCATCGAGGAGC
TACTGCTGAGCCATCGCCGCACCAGTGCGACCCGCACCAAGACATGGCAGGCTCTGATGCAGCGTCGCCTTCCCTTGGCGCCTATCGTAGCCAAGTACGT
GCTGCCGCTCACGCGGCGGCTGCGGACGCTACAGTCTCTGCTCGTGCGCGGCACCGATATCCAGAGCCGCTTCTACCTCGTGTGGCTGCGTCTCGTGGCG
GTCTGCACGGTCTTCATGGCCGTCGCACTACCGTACCGCCTCGCGTACGACTCGCTCCAGCGCGCCACCTTCCTCCCCGTGTGCGAGCGCATGTTCGAGA
GCCTGAGCGAGCTCGTCTTCATGTGGGACATCTGGTTTCACTTCCACGTGCGCGAGAGCCACGAGTCGATGGAGCTGTACGAGCAGGATCACCTGCAGGC
GTACAAGCGCGACCGGCTGCTCGTCGACTTTGCGGCCGCGTTCCCGCTCGACCACTTCGTCTCGGGCTTCGTGGCGCTCGCGACCGGCCAGAGCGCCTCG
GGCAGCGTGCGCCGCTGGCTGCGGCTCAACCGGTGCGTCAAGATGGCCAACTTTGTCTACTACCGCAACGAGATCACGCGCTGGAGCGTCGCGTACGAGG
CCAACCGCGTCGTGACGCTCTGGCTGCAGTACGTGCTCGTCATCTTCTGGACGTCGTGCGCCTACTTCGCCGTGGCCATGCACGAGGGCTTCGGCGCGCA
GTGGCAGGCGTGGCGACCGCCGCACGTGCTGGACCTGTCGGACGACCCGCCGTCTGAATTGCTGCTGCTGCGACTGCTTCGTGGCTTCTTCTATGCTACC
ACGGCGTTCGTCAAGAAAGGTAAAACGTTCGTACCGCAGGCCGAGCTCGACACGGCCTTCAGCATCATCGTGAGCTTCGTGGGTCAGCTCGTCATGGCGC
TCATGATCAGTGAGATCGCGAACGTCTACTTGCTCTACATCGACAACGAGGTGCAGTTCCGCAAGAGCCACATTACGGTGGAGCATTTCCTCGCGCGCTG
GAAGGTCAGCGCCGAGCTCAAGCTGCGCGCGCACGCCTTCCTCACCTCGTGGTGGGCCTCGCACGCCGGCATCGACTACCAGCTCATCTTCAACGAGCTG
CCGCGGTCGGTGCGCACCGAGGGCGTCGCGTGCATCGTGGCTAAGCCTCTGAGCAAGTTCGTGGCGCGCACTTTCCGTCCGCTGTTGCCGCGGATCGTGG
ATGCGGCGGCTGTCGGCTTTGATGCCGTCGACGACGCGGGCCACCGACTCGCTCGAGCCATCGCGCAGCAGCTGCACTTCGAGGGCTACCCTCGCGACGA
GAGCGTCATCGTCGAGGGCAGCATGTGCAAGGCCATGTACTTTGTCGTGCGTGGCTACCTGTTGTCGAGGAGCATATCGAATCCGTCGCTCTACCACGGC
GGCCGCTTCCGCAGCGGCGACTACTTTGGCGAGACTGGGCTGCTCGGCCACTCGGTCAGCCTCTACACTGTCACGACCATCCGCGCGTGCGACCTGTTCG
TGCTCGACGCGCAGCGGCTCGAGGAGATCGTGCGCACGCATCCGTTCTTCGGACTCGTGCTGGAGGTGGCCACTGTCGCTGTCCGACAGAAGAAGACGGC
GGCCGAAATCTTCGTGGGCGACAAGGTTGGCGACGGCGAGGGTTCTCGCAAGGGGAGCGACCGCTACACGACGTTGGTGTCGCGCATGTCGACTGGGGAC
ACTCAAGGTCACAAGGACGAAGAACCAGACGAGAACTCGCCGTCTGAGACGGCCTACCCTTGCGTTGGCCAGCTAAAGCAGCTGATGGGTGTCCAAGCGC
TGGAGCTCATGTGGCGTGCCGCGTTCACGCAGTTCTGCGAGCTCATCCTGGCGCGTGGATCGATGGACAAGGACGAGGAGGGCGATCAGCCTGCGGTGAA
GCCCGGACCTGTCCGAAGCAACAAGAGGAAGCGGTCTGTCGAAGGACCGGCTTTCTCCCAGCTACCTCGTATCGAGAAGTAGTCTAAGCACTTGAAAACT
AGCGCTTGTTTGAGTAATGATAAATAATTATTGGAGTCCTTGCTCCCACCGCACTTGCAGCACTCACCCGCATCACGACACCATGAGACAGAGGCTACTC
CTCCATCTCCATCATCCGCTCAAGCCGCATGAGGATCTTGGTGAGGTTGACCATCTTGCCCTCGAGCCGCTGCTCCGTCTCGAGCAGCCGATCCTCCATG
GTCTGCTGCATGTCGAGCAAGCGCAGCAGTAGTTGCTCCTCGTCAATCATAAGGCTGCGCGCGGATCGCGTGAAGACAGCTAGGTCCTGTTCGATTGTGC
GGATCGGTGTGCGGATCGGCGTGTGGAGCTCGAGGCTCGGCTTGGGCTCCAGTGTCGCCTTCTCGGGTACGGAGGACGGCGGCGAGCTGGCTGGCGCACG
CGGAGGAGGGTGTAGGTCGTGTGGTCCGCCCGAACCGGCGAGCTGCCGCACGATGTGCTGCATGGCCGCCACCTGCTTGATCGATGGCGCCGATCCGCGC
TGGCCGCCCGGCGTCGGCTTGGCGAGCTGCACTTCCGGCACACCCATCTGGCTCGCCATGGCGCGGTTCTGCAGCACCTCGAGGTCGTGGCGGAAGCGCG
CGAGCTCCTCGTCCTCGAGCATGCCGCTGTTGTCCGTGTCGTAGACGTTGATGACGTCGTCGATGTCGAGGTGGATGTTCTCGGTGACGGCGTGGAAGCG
CTGCAGGATGGCCTCGATCTCGTCGCGGCACAGCATGCGCTTCCCCTTGAGGTAGTCGACGTTGGTCTTCATGGTCTCGTGGATGACCGACTTCATCACC
TTCTGGAAGTTGGTGCCGATCACTGTGATCGGCAGCGCCAGCACGAGCATCCCCGTGAGCACGGTGGCGAAGCCCACGATCTTGCCGATCGTCGTCACTG
GCGTCATGTCGCCGTAGCCGACCGTCGACATGGTCACGATGCACCACCAGAAGGACGACGTGATGCTCTTGTACGGGTTCGGATCGACGCAGATGCACTG
GTTGGAACCTCCGGCAGTGACGACGCTTGCGGCAGCCTGGGCAGGCGACGACGCATATTGGACGGCGATACTGTCATCGTCCGGGCAATTGCCGATCCAC
CCACCAGCGCGGCAGCCGTCGGGCGTGAGCTCGGCGAAATAGACAGCGCTCGAGAAGATGATCATGGCGATCGACATGAGGAAGATGAGCATCGTGAGCG
GCTTGACGCTGATCGAGATGGCCTGCACGAACACCTGGATGGCCGACGAATAGCGCGACATCTTGAGCACGCGGGCCACGCGAGTGAGTCGCACGATGCG
CACGGCGCCAAGAGAACTCGCGCTCTTGACGGCCAGCATCCGCTCGAGGTAGTAGGGCAAGATGGCGGCGATGTCGATCCAGTTGGCCAGATCTGTAGAC
CACACACAGGATGGTTAGTCAGGCTGCCACCATCTGGAACATTTCGACCATACTCACTGCGGAAGAACGCGAACTTGCTGGGACAGAAGAGCATGCGCAG
CACGAGCTCGAGCGAGAAGACGACCGCGCACACGGTCTCGACGTACCCGATCTGGGTCTCATATGGGTCCATGGACGGCTCTGTGTCGATGATGAACGTT
GCGGTCGAGATGACGATGAAGGCAAAGATGGTCACGGACAGGTAGTACGCGGTCGTCGACGAGTTAGGATCGTCGATCGTCAGCCACACGGTTTGGCGCC
AGCTTCGAGGCGACTCTGTCTCGGCCTCGCTCGCAGAAAACACCTCGGACCGGCGGGAGGACTCCTCGCGCGCCAGAGAGGATGGCGCTACCGGCCCGAC
TGATGACACCTTCCTACCTTCTGTAGCTCTGAAGGATTTGTCCTCGGGCATCGGTGCCACGATCGACGAATCTCGCCCGCGACTGCGAACACTCCGAGTT
CCCGCGGACGTTCGTCGACTCATCGAAGAGTGGCGGAACGACGTCGGGATGTTGGCCTGCACGCGGCCCATCTTGGAGTTCCGCAGTCCCGACCGCCGCT
TGGCCTCGCGCTCGATCACCTTGGACAGCTTGAGCGCCGTGTCCGTCATCTCGAGCCCCGGGTCCATCATCTCGATTGCCGTGTTGCTCACCAGCTCCCG
CTGTCAGATCGGTGGATGTCCAGACAACTGCAAGCGGGTCGGGACCCCGGCTCCAGGGATCTGGTGTTGTGATGGGGAGTGGACGGTCCTGCCAGTCGGC
ACGAACGCTTCAAAACAAATGTTTCCCAGCAGCTCGACGACTAAAAATATGGTGCGAGATGCAATCGTTTCGATCGAATCGTTTTGGTGGCGGCGATGTC
AGCGGAATTGGTCGGAGACTGCAAACGAGCACTCTATTGACCGTGCGTTGATGAAGCCCAGCCCACCGAAATGCTGCTGGTCACACCGTCTCCATCTTCC
TAGCTATCAGTCGTTGTGGAGGACGCAGTCGGAGCAGAGGCTGCCTCGGTAGCGGCGCTAACCGCAGCTGGCGGCGGCTGCTTGGCTATCAGAGCAGCCT
TGGCAGCCTCCAGCTTAGCGGCGCGGTTGGGCTGCTTGGCTTCCTCCTCCTTCTCGGCCTTCCACTCGGCGTACGACTGGCTCACGTACCCGAACGGGAG
CAGCTCGAGCGTGCGCAGCCACTTGGCGTACGTGCGGGTCGCCTCCTCGTGCTTGATGATGTGCTCGAAGATGAAGTCGTGCTTGAACTGCTCCACCTTC
TGAGCCACGTCGGGGTCGTCCAGCGTCAGAGGCGGGTGGGACACCTGGATCGAGTCCTGCATCTTGGTGTTGTACACCTCGAAGTGGGCTTGCGCCAGGT
ACAGTCCCACGCTCGGCGCCTTGGGCAGATCCATCTTCTCCAGCTCCGTGGCGCGCGAGATCGTTGATGCATCCGTGACGCCCGCGACGACCTCGACCGC
CATGCCGATCATCTTGCGGATGTGGTGCAGCAGGAAGCTCTGGCCGACGACGCGCAGCCGGATCCACTCCATGTTGTTCTGCACGAACGGCCGGTCAGCC
GCGAACGAAATGATGAAGCGCAGGCACTTGGGGCTCTTGGGCTCCAGCTTGGACGTGAAGTTGTGGAAGTTGTGCGTGCCCTCGAACAGCTTGAGCGTCT
CATTGATGCGCTCGAATGTCTCGTCGCTCAGCCGGAACTGCTGGTGCCTGGCGAGCGTCGAGGCGTCGATGATCAGGTTGCTATCGAACCCATCCTCCGA
GTCGTGCACGCCGGCCTCCCGCTCTTCGGTCGCTTTCGCCTCGTCCGCAGCCATGGGACGCGCGCGCTTCCCAAAGATGAAGGTCGGCGCCAGGTACTCG
TACGTGCGCTGGTCGCACGACATCTTGGCATTGAAGTTTTTGGTCACGGTCACCATGTGCATAACGCGAATGTCTGCCGGCAGCGCCTCGTTCACCTTGG
CCATGAACGCCTGGAGGTCGTCGCCCACGTGCAGCTTGGCGGTCATGAGCTGTCCGGCGGCGTGCACGCCCTTATCGGTGCGCGCGGCGCGGCTCCACCC
GATCTGTCCGTCCACAGCGTCAGTTGTAACTGTAACTGTGGTATGACAAGCCCAACACGACCGCCACTGACCTTCTGCAGGAAGCCGTAGTTGCTCTCGG
CGATGGCGCCGGCCTCGAACAGCGCGCGCTCCAGCTCGGCCTCGATGGTCTGCACGCCCTCGTTCCTGCCGTCAGTATCGATCAGTTAGTGACTGTACTC
CTCCATCTAGTCTATAGAAGCGCGCACATTTGCATGCCGGAGTACTCCTTGCCGCAGAAGGCGACCCAGATCCCGTAGCGCCGCTTGGGGAAGGGCGACG
CCGGCTTTGGCTCCGGCGCCGGCTCCTCTCGCGCGCGAGCGGCCGCATACGAGCCCGGGTGGATGGTCTCAGAGAAGCCCTCGCGCCGGTCGCCGCGGTC
GCTCTTCTTCTTGGCGGCGTCCTCCTCGCTGCCGGCCGCCGCGCGCGCCTGCTTCTGCTTGCGGCGCGCCGCCCAGTGCGTCGCCTTGCGCTTGCCGCCG
CCCGCCATTGGTGCCGCTAATGGTCTCAATGCGGTCTGAAGCGATCACTGTACCGTGTTTTGGATAGTCAACAACCATGTTCTGTCACATTCTCGATTTG
GGAAGTGTCAACACTTTAAATAGTGGCCTCCGGGTCTGAGTGACATGCCACCCCACAACTTGAGAGCCGAGCCAGTCGCACAGGTCGGTCATGGTGCTGC
GCGCGAGTTCGCTGCTGACGCTGGGGCGTGCGGCGGCCGCCCGCGCTGCCCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NAGGCACCGGCTGCTGACGCCGGCGGCGCGCGCGTTCTCCGTGGCGGCGTCGGGTCACGGCAGCACCGTCCACAAGGACGAGGAGGCGGTCGACCCCAAG
GCGATTCTGCGGCCGGAGCTGCCCGCGACGCTGCACTCGCAGCTGCCGCTCGACAAGGAGCTCCCCGGGTACGTTTCTCTCCACTGCTGGCATCGTAGGA
AGCCTGTGTTGGTCGTGTTGTAACTGACTGGTGTATTGTTTGTCAATGGTTAGGCTGCCGAAGCTCAAGCCTGCGAGCCAGCTCGCGGCGCCGCAGACTG
AGATCTCGGTGCTGCCGTCCGGCCTGCGCGTCATCTCGCAGGAGACGTACGGCCAGGCCGCGACCGTGGGCGTGTTCGTCGACGTGGGCAGCCGCTTCGA
GGACGGTGCGTGGCGTCTGTGACTTGTGCGGCCATGGGAGACTACAGACTGACTGACCGTCTGGTATATCCTGGCCCGACAGACGAGAGCGTGGGCGTGA
GCCACCTGCTGGAGCACCTGGGCTTCAAGACGACGCAGACGCGCTCGCACGCGCAGCTCGTGCGCGAGATGGAGGACATCGGCGCGCTCACGACGGCCTC
GAGCGGCCGCGAGCAGATCATCTACACGATGGACCTGCTGCGCGACAACGTCGAGCACGGGCTCGAGCTACTGGCGGACGCCGTGCTCAACGTGGCCATC
CTGCCGGACGAGCTGGAGGACATCAAGGCGATCATGCGCATCCAGACGGAGGACCTGCTGGAGAACCCGCAGGCGCTGCTGCAGGAGCACATCCACGCGG
CGGCGTACGGCGCCGACTCGGCGCTCGGCCGCCCGCTGCAGTGCCCGCTCGACAAGATCGACGCGCTGACGGCCGACGCGGTGCGCGCGTTCCGCGCCAA
GCACTTTGTGGCCGAGAAGATGGTGCTCGCCGGCTCGGGCGTCGAGCACCAGACGCTGGTGGACCTCGCGAGCAAGCTGTTCGCCAAGGTGCCCAAGGCG
TCGCCCGAGGTGGCCGCCAAGATCGGCAAGCTCGACCCGGTCGTGTACACTGGCGGGCTCGAGACGATCGCCAACCCGGACGCGCCGTTCTCGTACGCGT
CGCTGGCGTTCCCGACCGGCGGGTGGCACGACGACGACCTCGTGCCCGTGTGCGTGCTGCACACGCTGCTGGGCGGCGGCGACAGCTTCTCGGCCGGTGG
CCCGGGCAAGGGCATGTACTCGCGGCTGTACACGAGCGTGCTCAATCGGTTCTACTGGGTCGAGTCGGCCTTCGCCTTCTCGTCCATCCACGCGGACGTC
GGGCTGCTCGGCATCTACGGCGCGGGGCTGCCGTCGCACACGAGCAACCTCGTGGCGCTGCTGTGCAACCAGCTGCTCAACCTGGCGAACCGCGCCGTCG
AGCCCATCGAGCTCGCGCGCGCCAAGAACCAGCTCAAGTCGTCCGTGCTCATGAACCTCGAGTCGCGCATGATCCTGTACGAGGACATTGGCCGGCAGCT
GCTCACGTACGGCCTGCGCGAGAGCCCCGAGTCCGTGTGCGCCAAGATCGACGCCGTCACGGCCGACGACCTGCAGCGGATCGTGCGGGCCGCCATGGCC
CACCCGCCGAGCCTCGTGTACTCGGGCGACCTCAAGCTCTTCCCGCAGTACGAGCAGGTCGTAGCGGGACTGACCGAGGGCATGGACAAGTAGAGAGACT
CAGAGAATGCAGGTGGCGGGTAGGAGCAGGGTGCAATGCATTGACAAGCAAGAAAAGTAGTGGCGAGTTGCCCTGCGCTCAGAAGTAGTTCGATGCCGTA
TGCTTTGGCGATAGGTGGCGCGGAGACTGCGGCGGGCTGGTGGTGGCGGTGGCTTGGTCGAATGGCGACGGCTGCTGCTCTGAAGCCTGCAGCAGTCGCT
GGCGAGTGGCGGCGGCTTCGTCTCGCAGCAGGCGGAAACCGCGCAGCAGCAGCGCGCGCTGGTCGGCGCTGTCGGCCATGAGGTCGAGCGTGCGACACGG
GTTGAGGAACACGAGCGAGAGGCAGCAGATCGGAGTCGCCGGTCGCTGGCGAAGGAACACGTCCGTCACGGCGCCGGGGATCACATCGAGCAGGTCGCTC
GTGTCGCACACGGCGTCCGTGCGGGGCGTCGTCGGCGTCGTCGAGGCTGCCGGCGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNTGTGGCACGCCGCGAGAGCCGAACTTGGTGACCGTCACGCCGCCGGCGAGCTGCGTCTTGAACCGCGCCAGGAACTCGCGGTC