Description :
From Genome Similarity Track
Location :
Scaffold_62:55644- 59634
Transcript NameFunction/comments
Pytve_DAOMBR484maker-pve_contig_62-snap-gene-0.34Mediator complex subunit 4
Pytve_DAOMBR484maker-pve_contig_62-fgenesh-gene-0.6DnaJ (Hsp40) homolog, subfamily C, member 11

Sequence
3990 bases(100 bases per row)
TTCAATCACTGTCCTCATCACTGCTGTCCTCGTCGGACGAGAGACTGAGCGATATCTTCTGCGGAGCCTCTTTATCTGAGTCGTCACTGTCGCTCGAGTC
ACTGTCGCTGTCGCTGTCCTCCTTGCCCGAGGCCGTCGTATCGCCGCCAGTGTCATCAGCGCTCTCGCCGCCATCGAGCTTACGGCGCTTCCGCAGTGTC
TCGACATCATCCACGACCTCGTCTTCGTACAGCGCCGCCCGCTTCTCCGGCAGCTTGAACTTTTTGCGTAGGATCTCCATTGCGTCCGGCGGCAGTGGCT
CACCCGGCTTCCACGACTCGGGCAACGCGATCCCATGCTCCTGCAATACGCAAATGTGCAGTGTCAGCACCATTATCCAACTCCATGCGATCGTTCCACA
CGCACCACAAAGAAGCTTCGCCCCATGTAGTGCAGAAGAGCGTCGAGCGGAAGGTCCACCGGGTCGCCAGGCTTCCATCCGGGCGGCATCTGTTTGCGGA
TCTGCGCATCGCTGGCCGCGAGACCGATGGGAATGTTGAGCTTGTCGAGGGCGTCGCCCGCGCTGCTACCCTCCTCCTTCTTCACCTTGGCCGCAGTTGA
CGAGTACGATTCCGGCTCGTGGGTCACGATCTCGTCCACGACGCCACGACTCAGCACGCCAGCGCGCATCATGTGCTCCTGTGGAGCCGGCGGCATGAAC
CCGAACATTGGGAACTGAAAGCAACCCACGAGTTAGAGTTCGACCAACACAGTAAATGCCGAGATTTGCTACGTACACCTGGCCGCCATTCTTTCGGGGC
GGACGTCGTGCCGGCGATCCGATGCGCGTACGCCACGACATCACGGGGATCAAGCACCACTGGTCGGTGTCAAGTAATCATCCATCCAGCATCGTTGTCA
GCGACATCAGCTGTTAGACGACATTAAAACAGCGCAGCAAGCCCGCACCTTTGGTCTTCTGACGAGCGTGCTGCAGCACTGTCTGGTGCTTCCGCAGCAC
ACTGGCAATTTCCTGTGCGATGCGAAGCAAGGTGCGAGTCAGCGAGCAGCTCATCCTCCGTTCCGACCGAAAAATGCAATGCTTCTCACTTCCTGCGACC
GCCGCAACTGCCCAGCGTAGTCGATGACCTTCTGCTTCTTGCTCTTGATGTCGTCCTGCAGGCGCAGCAGCTCCCGCTGCGTTTCCTGGTGGCGAGCGAC
TACGGCACAAACACGCAGCGTGAGGGAGGGGAACCAAACCACGAGCGCTATGCGATGCAACGCACGCTGCTTAATAGCGGCCAGGAGATCGCGGTCCTTG
TCCAGAACCTTGGCGAACGTGTCATTCACGGTTCGCAGGCGCGTCGACGTGATGGTCGTCGGCGGGCTGTTGTGAACCATGATAAGAAAGCCCGTTCTCC
GTCAGTTTAGGATCTGCCCGAGCGCGAGAAGTGCGGCAGGAGCACGCACAGCAGCGCCGCATTGAGCGACTCGAGCAGCTTGGTGACGAGGAAGCGGTGC
TCGTGCACGTGCACCTCGACCTGCTCCCGGACACTCCCTCCCAGTCTCGTCATGGTACCGACTCCGCTTTCCCGAGATCGAGGCTAAAATAACGCGATAG
CTCACGGTTAGCAACACATTTTGTGTCATGTGGCCCACATTCCTTTCCGCAATTTGTGGCGGTGACAACCAATCCACCATCATTCCGCAGCAGCTTTCCT
TTCCCCCAAAAGGAGGAGACCATGGCGGACGGTGGCCGTGGCGGCGCGAATGGCGGCGCCAAGGGCCGGGGCGACGCCTTCTGGCGGGAGCTGGAGCGCG
ACTACTACGCGCTGCTGGGGCTGCGTCGCGACGCGCAGAGCGACGAGATCCGCAGTCGTTTCCTGGCGCTCTCGCGCGAGTTCCACCCGGACCGTCAGCG
CCGCTCGCGCGACGCGGCGCTCGTGGCCGCCGCCAACTCGCAATACGCGCTGCTCGACCGCGCGTACAAGGTGCTCTCGGACCCGGTCACGCGCCGCGTC
TACGACGTCTACGGCGAGAAGGTGCGCTGTGAGAATGGATCGAGTTGTGGGTACTGAAAGATACTCATTTGCATTATTGTGTTCTGTGCTGTGATGTAGG
GGCTACACGCGCTGGAACAGGACGGTGCTGCGCAGGAGTTGGCTGTTGGTGCTCACTTGAAGTCGACGGACGAGGTTAGAGGACTGAATGAATGGGATGC
TATTTGGTGGGAGATAATGAAGACTTAGAGCTCTTTCGTGATGCCAACGCAGGTCCAGCATCATGTGGAAGAGGTGATCCGGCGCATGAACCAGCAAGCG
CTCGAGGGTCAGTTCTCGTCCTTTAGCGAGATGTCGATGAGTGTGGACGCGTCGGACTTTGTGCGCGAGCCGATGCTTGGGCTGCGCAGCTTGTTCCAGA
GCGGCGCGCGGTATGTGGCGCGCAACGAGATGACCATTCACCAGCGCACGTCCTTCCCGCTCTCGCGAAGCAACACTCTCACGCTCGGCGGGTACATGTT
TGACAAGAACGGCCTTGGTATTGGTAGCTTCACGATGCAGTTCGCGCACACGTCGTTCGACCCGAGCGTGCCGTCATTCACGGTGACGAGTGAGATGGGG
TGGACACCCAAGCTGCACTGTCAGATCAGTCAGCCTGTGTCGCCGCAGACGGTGTTCATGCTCATCCCCGAGGTGGATGACAACGGTCTGGATATCTCTG
TTGGAGCGAATCAAGTGTTGTCAAGCCAGCTGCACGGTGCCATGATGTGGAGCACCCGCGATGGACTCTCAGGTTCGATCAGCAGTGACACCGGGACGTC
CAATGTGACGGCTGCCGTCGCAGTCGGGCGGCGTGGCCCCAACTTGTCGCTCCAGCTCCGCCGCGGCATGGTGCATTCGTCCAACGTGAAGTTGTCGTTG
AAGGGGAGTCTGGCCACGGGACTCTCGATGATTGCCGGCGTGAGCAAGGAAGTGTCGAACCGAACGCGCTTGGCGCTTGGGGTTGTGCTTGCCAAGGCTG
GTGTCACGTTGCGGCTCGGGTTCACGCGTGGCAGCGTTCGATTCGTGATGCCCGTGTTCTTGTCGCCGTTTTCGGCTGAAACTGCATTCTCGACATTCTG
CGCTGCAACGTCTCCATTTGTGGTTGCTGCCGTGGTCAACCAGCTAGTCAAGCCGGCTCAGCAACGGAAGAGACTGCGCGAGTTGGAAAACCGCCGCGCT
GCACGCCTCCAGTACCTCGCAACTGCTCGAAGCGCTGCGCTTTCCCAGCAACGGTTGATGCGTCGGGTTGCGCAGGAAAAGCGAGAGCAAGAAGAACAGC
GCTCGGACGGCAAGGGACTGGTGATTATTATTGGTCGATACGGGAGCAATCCGACGAGTCCGGACTCGAGACAGCCGCGCGATGAACTGGCCGAGGCGCT
CGCAGCATTGAACGCGAGGCGCGACCTCGTCGAAGGCGGTGTGTTAGACGACATCCCGACGAATGAGGAGATCAATACTTCCGAGTCCGACAGCGAGGCG
GGGACCGTGGAGCAGCAATGGGTCGACGTCACGATTCCGCTCCAGTTCTTCGTCAATGTAAGTGTCTCGTCGGATGGTAGCAGGTTGATGATGTGGTGAT
GACTGACGGTCGGCATTTGACACAGGATGGGGTTCTTTCGCTTCAATCGTCGTCCAAAGCCGGTCTGCTCGGATTTTACAATCCGTGCGTCAGTAGGGAT
GACACCATCGCTGACGCTCGCGCATCGAGTTCTGGGTCTGGCCCCAAGCCACTATTGTGCGTGCTGTTTGCGAGTATGACGGGGATGCTGTTTCACTGAC
TTGGGATTATGCAACCTCGTTGCAGGTATGTTCGGTACACCTACGATGGCCATGTGTTTGAAGCGACCTTTGACAACGACCAGGTCGTCAATTTGCCGTC
GCGGTACGCTCAAGTCATGGGTCCGGTGGGCAACGTGTTCTGAATCTGGAATAGAGAAACGGTGTGAATGGCGAAGCCGTCAGGAAGTGG