Description :
From Genome Similarity Track
Location :
scaffold_22:55627- 57122
Transcript NameFunction/comments
Pl_112022conserved hypothetical protein

Sequence
1495 bases(100 bases per row)
AACTAACATTAAGCTGTGAAGTGAGCAGCAATTTTCCTCCTTGAATCGATCGAGGAACGAAAAGTAACAGCGATCCACCTCCTCTGCCAGGAATTCCTAG
GAACCCAGCTCGCCATCGATCCAAGTACAGAGTTTTGCCTGCTAACGTTGTCATATCAGAGACCCAAGTCACGTTGGTACCTGCCTTCACTTTGACTTGA
TCAACTTGATCACCCCCTGACATGATGTTTACATTCACATCTTCAGTGTCCTTGCTGTGAAATTTGATGGTGATTCTGCCGTCACCATTCTTGATCCAAG
ATCCAGCACTGTTGTTGAAAGCTTTTCCAACTGTAGTAAGACCCAAAGCGTCAGACGCGGGGCCATCGTCCACTTCACCTATGAATTCTGTAGGACCGCA
AATACTCTGAAAAAAATCCGAGGCAACGGTAGCGACGTTGGTGGGGTCCCAAACTGCCGCAAGCATCAGAATTTTGTCGCTAATGATGTATGCATATTCT
TCAGCAGTAAGATAAGAGCCATTAGAGCTCGTTCCAGAGCGAATGAGGTCGTCTACGATACCACCGAATGCCTTGCGTATATTATCCCGCGTGGCATATG
CAGTTGCCTCATCGGATTCATTGATCAACTGCTTCATGCAATTGTTCGTGACGGTGGGGATTTCGTGGTGCATGAGATTCGATTTACTCAAGATCACCCG
GATATCATCTTCTGAGATGCTCGGATTCTCTTTGCGTAGATATGTCACTGTCACCCATACACGGTTTGTTAGACGCTCCATGTCGTCTCCACAAGATGAA
TCCGATTCGAGGGCCGACTGCAGCGATGAAATGTCCGTCTCATCGAGGTTATCCAACCCATCATCCAGTGTGATATTCTTCATGAATGCTGTGAACGCTG
CCCAACTGGAAACAATAGCATCCTTGTTGGTCACAATCTCTTTCACAAACAGCTCGACAGTGTTGGTAACTCGGTCTGAGAATTTCATAGCTTTTGAAAC
CTTGATCCCGAGACAAGACATGATAGTGATTGGTAAGTCGAAAACGACGTTGTCTGTCTGGTACAACATTGTCATGAGTTGGTCCGTCGTAGTCTGCGGG
TCGTTAACCTGAACAGTTCGTACATATTTCGTCGAAGCCTTCACTAAGTTTGCTATTTCTTTGCCACACTTAAACGCAGTTTGAAATCCTTTTGCCATCT
TCGAGAACACACCGTATGCTCCAAACGTAGCTACTGAAAGTGCTGATTGAGCTAGAGCGGAGACTTTGGCCAGCATTTCTAGCGTACAGTCGTCGTTCTG
TCGAATGCACTGCATTCCACACTCGACGGGGTATTCTAGAGGACACTCTGCCCAACAAGTTCCGAGTTTGTTCTCGAAACCAAGTGGACACACTTTAGCA
ACGTGAGTTTCGCGATAACAAGCCATGTCTACTCCAGCACCATGTGCTGAACCAACCCAATTTTTGTAAGTCGATTCTAATGTGCTGATGTTAGC